3D Electron Microscopy (3D-EM) Data Navigator [English / [日本語]]
Top Gallery List Statistics Shape search Viewer
Movie pageYodrodumi (structure viewer)
PDBj>EM Navigator>Detail page - EMDB-8749

This page is a legacy version and will be discarded in future. The new page is here.

cryo-EM structure of the Cas9-sgRNA-AcrIIA4 anti-CRISPR complex

by single particle reconstruction, at 3.9 A resolution

Movie

Orientation:

#1: Surface view with section colored by density value, Surface level: 0.05, Imaged by UCSF CHIMERA

#2: Surface view colored by radius, Surface level: 0.05, Imaged by UCSF CHIMERA

#3: Surface view with fitted model, atomic models: PDB-5vzl, Surface level: 0.05, Imaged by UCSF CHIMERA

Entry
Summary
Database / IDEM DATA BANK (EMDB) / 8749
Titlecryo-EM structure of the Cas9-sgRNA-AcrIIA4 anti-CRISPR complex
MapCas9- sgRNA-AcrIIA4 anti-CRISPR complex
Samplethe complex of Streptococcus progenies Cas9 with sgRNA and AcrIIA4
AuthorsJiang F, Liu JJ
DateDeposition: 2017-05-29, Header release: 2017-07-26, Map release: 2017-07-26, Last update: 2017-07-26
EMDB SitesEMDB @PDBe (EU), EMDB @RCSB (USA)
Structure Visualization
MoviesMovie Page

#1: Surface view with section colored by density value, Surface level: 0.05, Imaged by UCSF CHIMERA

#2: Surface view colored by radius, Surface level: 0.05, Imaged by UCSF CHIMERA

#3: Surface view with fitted model, atomic models: PDB-5vzl, Surface level: 0.05, Imaged by UCSF CHIMERA

Supplemental images
Structure viewersYorodumi, Launch PeppeR (About PeppeR), Volume viewer (RCSB, PDBe)
Related Structure Data
Related Entries

PDB-5vzl

CiteFit

Cite: data citing same article

Fit: output model of fitting

Similar-shape strucutres
Search for similar-shape assemblies throgh:
EMDB + EM entries in PDB
all of EMDB & PDB (Omokage search)
Article
Citation - Primary
ArticleSci Adv, Vol. 3, Issue 7, Page e1701620-e1701620, Year 2017
TitleDisabling Cas9 by an anti-CRISPR DNA mimic.
AuthorsJiyung Shin, Fuguo Jiang, Jun-Jie Liu, Nicolas L Bray, Benjamin J Rauch, Seung Hyun Baik, Eva Nogales, Joseph Bondy-Denomy, Jacob E Corn, Jennifer A Doudna
Innovative Genomics Institute, University of California, Berkeley, Berkeley, CA 94720, USA.
Department of Molecular and Cell Biology, University of California, Berkeley, Berkeley, CA 94720, USA.
California Institute for Quantitative Biosciences, University of California, Berkeley, CA 94720, USA.
Molecular Biophysics and Integrated Bioimaging Division, Lawrence Berkeley National Laboratory, Berkeley, CA 94720, USA.
Department of Microbiology and Immunology and Quantitative Biosciences Institute, University of California, San Francisco, San Francisco, CA 94158, USA.
Howard Hughes Medical Institute, University of California, Berkeley, Berkeley, CA 94720, USA.
Department of Chemistry, University of California, Berkeley, Berkeley, CA 94720, USA.
LinksPubMed: 28706995, DOI: 10.1126/sciadv.1701620, PMC: PMC5507636
Map
Fileemd_8749.map.gz ( map file in CCP4 format, 67109 KB )
Projections & SlicesSize of images:
AxesZ (Sec.)Y (Row.)X (Col.)
256 pix
1.07 A/pix
= 273.92 A
256 pix
1.07 A/pix
= 273.92 A
256 pix
1.07 A/pix
= 273.92 A

Surface

Projections

Slices (1/3)

Slices (1/2)

Slices (2/3)

Images are generated by Spider package.

Density
Contour Level:0.05 (by author), 0.05 (movie #1):
Minimum - Maximum: -0.1356536 - 0.21605033
Average (Standard dev.): 0.00034119125 (0.004950442)
Data TypeImage stored as Reals
Space Group Number1
Map Geometry
Axis orderXYZ
Dimensions256256256
Origin000
Limit255255255
Spacing256256256
Unit CellA= B= C: 1 A
Alpha=beta=gamma: 90 degrees
Pixel SpacingX= Y= Z: 1.07 A
CCP4 map header info
modeImage stored as Reals
A/pix X/Y/Z1.071.071.07
M x/y/z256256256
origin x/y/z0.0000.0000.000
length x/y/z273.920273.920273.920
alpha/beta/gamma90.00090.00090.000
start NX/NY/NZ
NX/NY/NZ
MAP C/R/S123
start NC/NR/NS000
NC/NR/NS256256256
start NC,NX/NR,NY/NS,NZ
NC,NX/NR,NY/NS,NZ
D min/max/mean-0.1360.2160.000
Annotation DetailsCas9- sgRNA-AcrIIA4 anti-CRISPR complex
Supplement
Images
Images
Sample
Namethe complex of Streptococcus progenies Cas9 with sgRNA and AcrIIA4
Number of Components6
Component #1: protein - the complex of Streptococcus progenies Cas9 with sgRNA and AcrIIA4
Scientific namethe complex of Streptococcus progenies Cas9 with sgRNA and AcrIIA4
Scientific Name of SpeciesStreptococcus pyogenes M1 GAS
NCBI taxonomy160490
Recombinant expressionNo
Engineered SourceNCBI taxonomy: 562
Expression system: Escherichia coli
Component #2: protein - Streptococcus pyogenes M1 GAS
Scientific nameStreptococcus pyogenes M1 GAS
Scientific Name of Speciesunidentified phage
NCBI taxonomy38018
Recombinant expressionNo
Component #3: protein - unidentified phage
Scientific nameunidentified phage
Recombinant expressionNo
Component #4: nucleic-acid - single guide RNA (116-MER)
Scientific namesingle guide RNA (116-MER)
Theoretical Mass0.038292645 MDa
SyntheticNo
Sequence(GTP)GCGCAUAAAGAUGAGACGCGUUUUAGAGCUAUGCUGUUUUGAAAAAAACA GCAUAGCAAGUUAAAAUAAGGCUAG UCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUCG
ClassRNA
StructureOTHER
Component #5: protein - CRISPR-associated endonuclease Cas9
Scientific nameCRISPR-associated endonuclease Cas9
Theoretical Mass0.158772891 MDa
Recombinant expressionNo
Engineered SourceNCBI taxonomy: 160490
Expression system: Streptococcus pyogenes M1 GAS
Component #6: protein - phage anti-CRISPR AcrIIA4
Scientific namephage anti-CRISPR AcrIIA4
Theoretical Mass0.010182073 MDa
Recombinant expressionNo
Engineered SourceNCBI taxonomy: 38018
Expression system: unidentified phage
Experiment
Sample Preparation
Specimen Stateparticle
Specimen Conc1.25 mg/ml
BufferpH: 8
Vitrification
Cryogen NameETHANE
Humidity100
Temperature281 Kelvin
InstrumentFEI VITROBOT MARK IV
Detailsblot for 4.5 seconds with force of 12 before plunging
Imaging
MicroscopeFEI TITAN KRIOS
Electron Gun
Electron SourceFIELD EMISSION GUN
Accelerating Voltage300 kV
Electron Dose46 e/A**2
Illumination ModeFLOOD BEAM
Lens
Nominal Cs0.01 mm
Imaging ModeBRIGHT FIELD
Defocus1000 nm - 3000 nm
Specimen Holder
ModelOTHER
Camera
DetectorGATAN K2 (4k x 4k)
Processing
Methodsingle particle reconstruction
3D reconstruction
Resolution By Author3.9 A
Resolution MethodFSC 0.143 CUT-OFF
Single Particle
Number of Projections185000
Atomic Model Fitting
Fitted Coordinate
PDB entry ID
Download
Data from EMDB
Header (meta data in XML format)emd-8749-v19.xml (8.2 KB)
emd-8749-v20.xml (14.8 KB)
emd-8749.xml (8.2 KB)
Map dataemd_8749.map.gz (5 MB)
Imagesemd_8749.png (120 KB)
FTP directoryftp://ftp.pdbj.org/pub/emdb/structures/EMD-8749
Movie files
movie #1
.mp4 (H.264/MPEG-4 AVC format), 3.3 MB
.webm (WebM/VP8 format), 5.9 MB
Session file for UCSF-Chimera, 26.9 KB
movie #2
.mp4 (H.264/MPEG-4 AVC format), 3.2 MB
.webm (WebM/VP8 format), 6 MB
Session file for UCSF-Chimera, 26.9 KB
movie #3
.mp4 (H.264/MPEG-4 AVC format), 3.6 MB
.webm (WebM/VP8 format), 6.9 MB
Session file for UCSF-Chimera, 1.3 MB