3D Electron Microscopy (3D-EM) Data Navigator [English / [日本語]]
Top Gallery List Statistics Shape search Viewer
Movie pageYodrodumi (structure viewer)
PDBj>EM Navigator>Detail page - EMDB-6788

This page is a legacy version and will be discarded in future. The new page is here.

Small subunit of Trichomonas vaginalis ribosome

by single particle reconstruction, at 3.35 A resolution

Movie

Orientation:

#1: Surface view with section colored by density value, Surface level: 0.036, Imaged by UCSF CHIMERA

#2: Surface view colored by height, Surface level: 0.036, Imaged by UCSF CHIMERA

#3: Surface view with fitted model, atomic models: PDB-5xyi, Surface level: 0.036, Imaged by UCSF CHIMERA

Entry
Summary
Database / IDEM DATA BANK (EMDB) / 6788
TitleSmall subunit of Trichomonas vaginalis ribosome
SampleSmall subunit of Trichomonas vaginalis ribosome
AuthorsLi Z, Guo Q
DateDeposition: 2017-07-08, Header release: 2017-08-30, Map release: 2017-08-30, Last update: 2017-08-30
EMDB SitesEMDB @PDBe (EU), EMDB @RCSB (USA)
Structure Visualization
MoviesMovie Page

#1: Surface view with section colored by density value, Surface level: 0.036, Imaged by UCSF CHIMERA

#2: Surface view colored by height, Surface level: 0.036, Imaged by UCSF CHIMERA

#3: Surface view with fitted model, atomic models: PDB-5xyi, Surface level: 0.036, Imaged by UCSF CHIMERA

Supplemental images
Structure viewersYorodumi, Launch PeppeR (About PeppeR), Volume viewer (RCSB, PDBe)
Related Structure Data
Related Entries

PDB-5xyi

CiteFit

Cite: data citing same article

Fit: output model of fitting

Similar-shape strucutres
Search for similar-shape assemblies throgh:
EMDB + EM entries in PDB
all of EMDB & PDB (Omokage search)
Article
Citation - Primary
ArticleCell Res., Year 2017
TitleCryo-EM structures of the 80S ribosomes from human parasites Trichomonas vaginalis and Toxoplasma gondii.
AuthorsZhifei Li, Qiang Guo, Lvqin Zheng, Yongsheng Ji, Yi-Ting Xie, De-Hua Lai, Zhao-Rong Lun, Xun Suo, Ning Gao
State Key Laboratory of Membrane Biology, Beijing Advanced Innovation Center for Structural Biology, School of Life Sciences, Tsinghua University, Beijing 100084, China.
Tsinghua-Peking Joint Center for Life Sciences, Tsinghua University, Beijing 100084, China.
State Key Laboratory of Membrane Biology, Peking-Tsinghua Joint Center for Life Sciences, School of Life Sciences, Peking University, Beijing 100871, China.
Anhui Provincial Laboratory of Pathogen Biology, Anhui Key Laboratory of Zoonoses, Department of Microbiology and Parasitology, Anhui Medical University, Hefei, Anhui 230022, China.
Center for Parasitic Organisms, State Key Laboratory of Biocontrol, Key Laboratory of Tropical Disease Control (Sun Yat-Sen University), Ministry of Education, School of Life Sciences, Sun Yat-Sen University, Guangzhou, Guangdong 510275, China.
State Key Laboratory of Agrobiotechnology &National Animal Protozoa Laboratory, College of Veterinary Medicine, China Agricultural University, Beijing 100193, China.
LinksPubMed: 28809395, DOI: 10.1038/cr.2017.104
Map
Fileemd_6788.map.gz ( map file in CCP4 format, 131073 KB )
Projections & SlicesSize of images:
AxesZ (Sec.)Y (Row.)X (Col.)
320 pix
1.32 A/pix
= 422.4 A
320 pix
1.32 A/pix
= 422.4 A
320 pix
1.32 A/pix
= 422.4 A

Surface

Projections

Slices (1/3)

Slices (1/2)

Slices (2/3)

Images are generated by Spider package.

Density
Contour Level:0.036 (by author), 0.036 (movie #1):
Minimum - Maximum: -0.13911201 - 0.26773617
Average (Standard dev.): 0.00029812296 (0.005232952)
Data TypeImage stored as Reals
Space Group Number1
Map Geometry
Axis orderXYZ
Dimensions320320320
Origin000
Limit319319319
Spacing320320320
Unit CellA= B= C: 422.40002 A
Alpha=beta=gamma: 90 degrees
Pixel SpacingX= Y= Z: 1.32 A
CCP4 map header info
modeImage stored as Reals
A/pix X/Y/Z1.321.321.32
M x/y/z320320320
origin x/y/z0.0000.0000.000
length x/y/z422.400422.400422.400
alpha/beta/gamma90.00090.00090.000
start NX/NY/NZ-190-190-190
NX/NY/NZ380380380
MAP C/R/S123
start NC/NR/NS000
NC/NR/NS320320320
start NC,NX/NR,NY/NS,NZ
NC,NX/NR,NY/NS,NZ
D min/max/mean-0.1390.2680.000
Supplement
Mask Set
Mask: #0
Fileemd_6788_msk_1.map ( map file in CCP4 format, 131073 KB )
Projections & Slices
AxesZYX
Projections
Slices (1/2)
Density Histograms
Data TypeImage stored as Reals
DimensionsNumber of Rows: 320 , Number of Columns: 320 , Number of Sections: 320
SpacingSpacing Row: 320 , Spacing Col: 320 , Spacing Sec: 320
OriginOrigin Row: 0 , Origin Col: 0 , Origin Sec: 0
LimitLimit Row: 319 , Limit Col: 319 , Limit Sec: 319
Unit CellA: 422.40002 A, B: 422.40002 A, C: 422.40002 A, alpha: 90 degrees, beta: 90 degrees, gamma: 90 degrees
Axis Order1: X , 2: Y , 3: Z
Statisticsmin.: 0 , max.: 1 , avg.: 0.024017747 , std.: 0.1485841
Pixel SpacingX: 1.32 A, Y: 1.32 A, Z: 1.32 A
Space Group Number1
Mask: #1
Projections & Slices
AxesZYX
Projections
Slices (1/2)
Density Histograms
Images
Images
FSC
FSC
Sample
NameSmall subunit of Trichomonas vaginalis ribosome
Number of Components35
Component #1: protein - Small subunit of Trichomonas vaginalis ribosome
Scientific nameSmall subunit of Trichomonas vaginalis ribosome
Scientific Name of SpeciesTrichomonas vaginalis
NCBI taxonomy5722
Recombinant expressionNo
Component #2: nucleic-acid - 18S
Scientific name18S
Theoretical Mass0.508656188 MDa
Scientific Name of SpeciesTrichomonas vaginalis
NCBI taxonomy5722
SyntheticNo
SequenceACUUGGUUGAUCCUGCCAAGGAAGCACACUUAGGUCAUAGAUUAAGCCAU GCAAGUGUUAGUUCAGGUAACGAAACUGCG AAUAGCUCAUUAAUACGCUCAGAAUCUAUUUGGCGGCGACCAACAGGUCU UAAAUGGAUAGCAGCAGCAACUCUGGUGCU AAUACAUGCGAUUGUUUCUCCAGAUGUGAAUUAUGGAGGAAAAGUUGACC UCAUCAGAGGCACGCCAUUCGACUGAGUGA CCUAUCAGCUUGUACUUAGGGUCUUUACCUAGGUAGGCUAUCACGGGUAA CGGGCGGUUACCGUCGGACUGCCGGAGAAG GCGCCUGAGAGAUAGCGACUAUAUCCACGGGUAGCAGCAGGCGCGAAACU UUCCCACUCGAGACUUUCGGAGGAGGUAAU GACCAGUUCCAUUGGUGCCUUUUGGUACUGUGGAUAGGGGUACGGUUUUC CACCGUACCGAAACCUAGCAGAGGGCCAGU CUGGUGCCAGCAGCUGCGGUAAUUCCAGCUCUGCGAGUUUGCUCCCAUAU UGUUGCAGUUAAAACGCCCGUAGUCUGAAU UGGCCAGCAAUGGUCGUACGUAUUUUUACGUUCACUGUGAACAAAUCAGG ACGCUUAGAGUAUGGCCACAUGAAUGACUC AGCGCAGUAUGAAGUCUUUGUUUUCUUCCGAAAACAAGCUCAAUGAGAGC CAUCGGGGGUAGAUCUAUCUCAUGACGAGU GGUGGAAUACUUUGACUCAUGAGAGAGAAGCUGAGGCGAAGGCGUCUACC UAGAGGGUUUCUGUCGAUCAAGGGCGAGAG UAGGAGUAUCCAACAGGAUUAGAGACCCUGGUAGUUCCUACCUUAAACGA UGCCGACAGGAGUUUGUCAUUUGUUAAUGG CAGAAUCUUUGGAGAAAUCAUAGUUCUUGGGCUCUGGGGGAAAUACGACC GCAAGGCUGAAACUUGAAGGAAUUGACGGA AGGGCACACCAGGGGUGGAGCCUGUGGCUUAAUUUGAAUCAACACGGGGA AACUACCCAGGACCAGAUGUUUUUUAUGAC UGACAGGCUUCGGGUCUUUCAGGAUAUUGUUUUUGGUGGUGCAUGGCCGU UGGUGGUGCGUGGGUUGACCUGUCUAGCGU UGAUUCAGCUAACGAGCGAGAUUAUCGCCAAUUAUUUACUUUGCCGAAGU CCUUCGGUUAAAGUUCUAAUUGGGACUCCC UGCGAUUUUAGCAGGUGGAAGAGGGUAGCAAUAACAGGUCCGUGAUGCCC UUUAGAUGCUCUGGGCUGCACGCGUGCUAC AAUGUUAGGAUCAAUAGGACUGCGAGCCUGAGAGGGUGCGCUACUCUUAU AAUCCCUAACGUAGUUGGGAUUGACGUUUG UAAUCAGCGUCAUGAACCAGGAAUCCCUUGUAAAUGUGUGUCAACAACGC ACGUUGAAUACGUCCCUGCCCUUUGUACAC ACCGCCCGUCGCUCCUACCGAUUGGAUGACUCGGUGAAAUCACCGGAUGC UUACGAGCAGAAAGUGAUUAAAUCACGUUA UCUAGAGGAAGGAGAAGUCGUAACAAGGUAACGGUAGGUGAACCUGCCGU UGGAUCA
ClassRNA
StructureOTHER
Component #3: protein - 40S ribosomal protein SA
Scientific name40S ribosomal protein SA
Theoretical Mass0.028584676 MDa
Scientific Name of SpeciesTrichomonas vaginalis
NCBI taxonomy5722
Recombinant expressionNo
Component #4: protein - Ribosomal protein S3Ae, putative
Scientific nameRibosomal protein S3Ae, putative
Theoretical Mass0.028085471 MDa
Scientific Name of SpeciesTrichomonas vaginalis
NCBI taxonomy5722
Recombinant expressionNo
Component #5: protein - Uncharacterized protein
Scientific nameUncharacterized protein
Theoretical Mass0.030083736 MDa
Scientific Name of SpeciesTrichomonas vaginalis
NCBI taxonomy5722
Recombinant expressionNo
Component #6: protein - Ribosomal protein S3, putative
Scientific nameRibosomal protein S3, putative
Theoretical Mass0.024505658 MDa
Scientific Name of SpeciesTrichomonas vaginalis
NCBI taxonomy5722
Recombinant expressionNo
Component #7: protein - 40S ribosomal protein S4
Scientific name40S ribosomal protein S4
Theoretical Mass0.028589561 MDa
Scientific Name of SpeciesTrichomonas vaginalis
NCBI taxonomy5722
Recombinant expressionNo
Component #8: protein - 40s ribosomal protein S5-B, putative
Scientific name40s ribosomal protein S5-B, putative
Theoretical Mass0.021672889 MDa
Scientific Name of SpeciesTrichomonas vaginalis
NCBI taxonomy5722
Recombinant expressionNo
Component #9: protein - 40S ribosomal protein S6
Scientific name40S ribosomal protein S6
Theoretical Mass0.024583883 MDa
Scientific Name of SpeciesTrichomonas vaginalis
NCBI taxonomy5722
Recombinant expressionNo
Component #10: protein - 40S ribosomal protein S7, putative
Scientific name40S ribosomal protein S7, putative
Theoretical Mass0.018708568 MDa
Scientific Name of SpeciesTrichomonas vaginalis
NCBI taxonomy5722
Recombinant expressionNo
Component #11: protein - 40S ribosomal protein S8
Scientific name40S ribosomal protein S8
Theoretical Mass0.022118488 MDa
Scientific Name of SpeciesTrichomonas vaginalis
NCBI taxonomy5722
Recombinant expressionNo
Component #12: protein - Uncharacterized protein
Scientific nameUncharacterized protein
Theoretical Mass0.021811295 MDa
Scientific Name of SpeciesTrichomonas vaginalis
NCBI taxonomy5722
Recombinant expressionNo
Component #13: protein - Plectin/S10 domain containing protein
Scientific namePlectin/S10 domain containing protein
Theoretical Mass0.016251438 MDa
Scientific Name of SpeciesTrichomonas vaginalis
NCBI taxonomy5722
Recombinant expressionNo
Component #14: protein - Uncharacterized protein
Scientific nameUncharacterized protein
Theoretical Mass0.018015252 MDa
Scientific Name of SpeciesTrichomonas vaginalis
NCBI taxonomy5722
Recombinant expressionNo
Component #15: protein - Ribosomal protein L7Ae, putative
Scientific nameRibosomal protein L7Ae, putative
Theoretical Mass0.013714954 MDa
Scientific Name of SpeciesTrichomonas vaginalis
NCBI taxonomy5722
Recombinant expressionNo
Component #16: protein - 40S ribosomal protein S13, putative
Scientific name40S ribosomal protein S13, putative
Theoretical Mass0.017071031 MDa
Scientific Name of SpeciesTrichomonas vaginalis
NCBI taxonomy5722
Recombinant expressionNo
Component #17: protein - Ribosomal protein S14
Scientific nameRibosomal protein S14
Theoretical Mass0.016689012 MDa
Scientific Name of SpeciesTrichomonas vaginalis
NCBI taxonomy5722
Recombinant expressionNo
Component #18: protein - Ribosomal protein S19, putative
Scientific nameRibosomal protein S19, putative
Theoretical Mass0.01628608 MDa
Scientific Name of SpeciesTrichomonas vaginalis
NCBI taxonomy5722
Recombinant expressionNo
Component #19: protein - 40S ribosomal protein S16, putative
Scientific name40S ribosomal protein S16, putative
Theoretical Mass0.015626175 MDa
Scientific Name of SpeciesTrichomonas vaginalis
NCBI taxonomy5722
Recombinant expressionNo
Component #20: protein - 40S ribosomal protein S17-B, putative
Scientific name40S ribosomal protein S17-B, putative
Theoretical Mass0.014964434 MDa
Scientific Name of SpeciesTrichomonas vaginalis
NCBI taxonomy5722
Recombinant expressionNo
Component #21: protein - Ribosomal protein S13p/S18e, putative
Scientific nameRibosomal protein S13p/S18e, putative
Theoretical Mass0.017564523 MDa
Scientific Name of SpeciesTrichomonas vaginalis
NCBI taxonomy5722
Recombinant expressionNo
Component #22: protein - Ribosomal protein S19e, putative
Scientific nameRibosomal protein S19e, putative
Theoretical Mass0.016584188 MDa
Scientific Name of SpeciesTrichomonas vaginalis
NCBI taxonomy5722
Recombinant expressionNo
Component #23: protein - Ribosomal protein S10p/S20e, putative
Scientific nameRibosomal protein S10p/S20e, putative
Theoretical Mass0.013933201 MDa
Scientific Name of SpeciesTrichomonas vaginalis
NCBI taxonomy5722
Recombinant expressionNo
Component #24: protein - 40S ribosomal protein S21
Scientific name40S ribosomal protein S21
Theoretical Mass0.00985313 MDa
Scientific Name of SpeciesTrichomonas vaginalis
NCBI taxonomy5722
Recombinant expressionNo
Component #25: protein - Ribosomal protein S15a
Scientific nameRibosomal protein S15a
Theoretical Mass0.014583213 MDa
Scientific Name of SpeciesTrichomonas vaginalis
NCBI taxonomy5722
Recombinant expressionNo
Component #26: protein - 40S ribosomal protein S23, putative
Scientific name40S ribosomal protein S23, putative
Theoretical Mass0.015592457 MDa
Scientific Name of SpeciesTrichomonas vaginalis
NCBI taxonomy5722
Recombinant expressionNo
Component #27: protein - Ribosomal protein S24e, putative
Scientific nameRibosomal protein S24e, putative
Theoretical Mass0.016069884 MDa
Scientific Name of SpeciesTrichomonas vaginalis
NCBI taxonomy5722
Recombinant expressionNo
Component #28: protein - Uncharacterized protein
Scientific nameUncharacterized protein
Theoretical Mass0.012645859 MDa
Scientific Name of SpeciesTrichomonas vaginalis
NCBI taxonomy5722
Recombinant expressionNo
Component #29: protein - 40S ribosomal protein S26
Scientific name40S ribosomal protein S26
Theoretical Mass0.013889256 MDa
Scientific Name of SpeciesTrichomonas vaginalis
NCBI taxonomy5722
Recombinant expressionNo
Component #30: protein - 40S ribosomal protein S27
Scientific name40S ribosomal protein S27
Theoretical Mass0.009467907 MDa
Scientific Name of SpeciesTrichomonas vaginalis
NCBI taxonomy5722
Recombinant expressionNo
Component #31: protein - Uncharacterized protein
Scientific nameUncharacterized protein
Theoretical Mass0.007650717 MDa
Scientific Name of SpeciesTrichomonas vaginalis
NCBI taxonomy5722
Recombinant expressionNo
Component #32: protein - 40S ribosomal protein S29, putative
Scientific name40S ribosomal protein S29, putative
Theoretical Mass0.0068431 MDa
Scientific Name of SpeciesTrichomonas vaginalis
NCBI taxonomy5722
Recombinant expressionNo
Component #33: protein - 40S ribosomal protein S30
Scientific name40S ribosomal protein S30
Theoretical Mass0.006919079 MDa
Scientific Name of SpeciesTrichomonas vaginalis
NCBI taxonomy5722
Recombinant expressionNo
Component #34: protein - Guanine nucleotide-binding protein beta subunit, putative
Scientific nameGuanine nucleotide-binding protein beta subunit, putative
Theoretical Mass0.037151832 MDa
Scientific Name of SpeciesTrichomonas vaginalis
NCBI taxonomy5722
Recombinant expressionNo
Component #35: protein - eL41
Scientific nameeL41
Theoretical Mass0.003354243 MDa
Scientific Name of SpeciesTrichomonas vaginalis
NCBI taxonomy5722
Recombinant expressionNo
Experiment
Sample Preparation
Specimen Stateparticle
BufferpH: 7.4
Vitrification
Cryogen NameETHANE
Imaging
MicroscopeFEI TITAN KRIOS
Electron Gun
Electron SourceFIELD EMISSION GUN
Accelerating Voltage300 kV
Electron Dose2 e/A**2
Illumination ModeFLOOD BEAM
Lens
Imaging ModeBRIGHT FIELD
Specimen Holder
ModelOTHER
Camera
DetectorGATAN K2 (4k x 4k)
Processing
Methodsingle particle reconstruction
3D reconstruction
Resolution By Author
3.35 A
Resolution MethodFSC 0.143 CUT-OFF
Single Particle
Number of Projections57162
Atomic Model Fitting
Fitted Coordinate
PDB entry ID
Download
Data from EMDB
Header (meta data in XML format)emd-6788-v19.xml (25 KB)
emd-6788-v20.xml (41.1 KB)
emd-6788.xml (25 KB)
Map dataemd_6788.map.gz (9.3 MB)
Imagesemd_6788.png (80.4 KB)
FSC (resolution estimation)emd_6788_fsc.xml (11.3 KB)
Masks (Map data of sub-region, etc)emd_6788_msk_1.map (125 MB)
FTP directoryftp://ftp.pdbj.org/pub/emdb/structures/EMD-6788
Movie files
movie #1
.mp4 (H.264/MPEG-4 AVC format), 3.5 MB
.webm (WebM/VP8 format), 6.4 MB
Session file for UCSF-Chimera, 26.9 KB
movie #2
.mp4 (H.264/MPEG-4 AVC format), 3.4 MB
.webm (WebM/VP8 format), 6.6 MB
Session file for UCSF-Chimera, 26.6 KB
movie #3
.mp4 (H.264/MPEG-4 AVC format), 3.8 MB
.webm (WebM/VP8 format), 6.7 MB
Session file for UCSF-Chimera, 6.8 MB