3D Electron Microscopy (3D-EM) Data Navigator [English / [日本語]]
Top Gallery List Statistics Shape search Viewer
Movie pageYodrodumi (structure viewer)
PDBj>EM Navigator>Detail page - EMDB-6777

This page is a legacy version and will be discarded in future. The new page is here.

Electron cryo-microscopy structure of LbuCas13a-crRNA binary complex

by single particle reconstruction, at 3.2 A resolution

Movie

Orientation:

#1: Surface view with section colored by density value, Surface level: 0.02, Imaged by UCSF CHIMERA

#2: Surface view colored by radius, Surface level: 0.02, Imaged by UCSF CHIMERA

#3: Surface view with fitted model, atomic models: PDB-5xwy, Surface level: 0.02, Imaged by UCSF CHIMERA

Entry
Summary
Database / IDEM DATA BANK (EMDB) / 6777
TitleElectron cryo-microscopy structure of LbuCas13a-crRNA binary complex
MapElectron cryo-microscopy structure of LbuCas13a-crRNA binary complex
SampleLbuCas13a-crRNA binary complex
AuthorsZhang X, Wang Y
DateDeposition: 2017-06-30, Header release: 2017-09-13, Map release: 2017-09-13, Last update: 2017-09-13
EMDB SitesEMDB @PDBe (EU), EMDB @RCSB (USA)
Structure Visualization
MoviesMovie Page

#1: Surface view with section colored by density value, Surface level: 0.02, Imaged by UCSF CHIMERA

#2: Surface view colored by radius, Surface level: 0.02, Imaged by UCSF CHIMERA

#3: Surface view with fitted model, atomic models: PDB-5xwy, Surface level: 0.02, Imaged by UCSF CHIMERA

Supplemental images
Structure viewersYorodumi, Launch PeppeR (About PeppeR), Volume viewer (RCSB, PDBe)
Related Structure Data
Related Entries

PDB-5xwy

CiteFit

Cite: data citing same article

Fit: output model of fitting

Similar-shape strucutres
Search for similar-shape assemblies throgh:
EMDB + EM entries in PDB
all of EMDB & PDB (Omokage search)
Article
Citation - Primary
ArticleCell, Vol. 170, Issue 4, Page 714-726.e10, Year 2017
TitleThe Molecular Architecture for RNA-Guided RNA Cleavage by Cas13a.
AuthorsLiang Liu, Xueyan Li, Jun Ma, Zongqiang Li, Lilan You, Jiuyu Wang, Min Wang, Xinzheng Zhang, Yanli Wang
Key Laboratory of RNA Biology, CAS Center for Excellence in Biomacromolecules, Institute of Biophysics, Chinese Academy of Sciences, Beijing 100101, China.
Key Laboratory of RNA Biology, CAS Center for Excellence in Biomacromolecules, Institute of Biophysics, Chinese Academy of Sciences, Beijing 100101, China; University of Chinese Academy of Sciences, Beijing 100049, China.
National Laboratory of Biomacromolecules, CAS Center for Excellence in Biomacromolecules, Institute of Biophysics, Chinese Academy of Sciences, Beijing 100101, China.
University of Chinese Academy of Sciences, Beijing 100049, China; National Laboratory of Biomacromolecules, CAS Center for Excellence in Biomacromolecules, Institute of Biophysics, Chinese Academy of Sciences, Beijing 100101, China; Center for Biological Imaging, CAS Center for Excellence in Biomacromolecules, Institute of Biophysics, Chinese Academy of Sciences, Beijing 100101, China.
Key Laboratory of RNA Biology, CAS Center for Excellence in Biomacromolecules, Institute of Biophysics, Chinese Academy of Sciences, Beijing 100101, China; University of Chinese Academy of Sciences, Beijing 100049, China; Collaborative Innovation Center of Genetics and Development, Shanghai 200438, China.
KeywordsBacterial Proteins (chemistry), Base Sequence, CRISPR-Associated Proteins (chemistry), CRISPR-Cas Systems, Leptotrichia (chemistry), Models, Molecular, RNA Processing, Post-Transcriptional, RNA, Bacterial (chemistry), RNA, Guide (chemistry), RNA, Viral (chemistry), X-Ray Diffraction
LinksPubMed: 28757251, PII: S0092-8674(17)30769-9, DOI: 10.1016/j.cell.2017.06.050
Map
Fileemd_6777.map.gz ( map file in CCP4 format, 32001 KB )
Projections & SlicesSize of images:
AxesZ (Sec.)Y (Row.)X (Col.)
200 pix
0.82 A/pix
= 164. A
200 pix
0.82 A/pix
= 164. A
200 pix
0.82 A/pix
= 164. A

Surface

Projections

Slices (1/3)

Slices (1/2)

Slices (2/3)

Images are generated by Spider package.

Density
Contour Level:0.02 (by author), 0.02 (movie #1):
Minimum - Maximum: -0.12865293 - 0.20330638
Average (Standard dev.): 0.00039493514 (0.0066677476)
Data TypeImage stored as Reals
Space Group Number1
Map Geometry
Axis orderXYZ
Dimensions200200200
Origin000
Limit199199199
Spacing200200200
Unit CellA= B= C: 164 A
Alpha=beta=gamma: 90 degrees
Pixel SpacingX= Y= Z: 0.82 A
CCP4 map header info
modeImage stored as Reals
A/pix X/Y/Z0.820.820.82
M x/y/z200200200
origin x/y/z0.0000.0000.000
length x/y/z164.000164.000164.000
alpha/beta/gamma90.00090.00090.000
start NX/NY/NZ
NX/NY/NZ
MAP C/R/S123
start NC/NR/NS000
NC/NR/NS200200200
start NC,NX/NR,NY/NS,NZ
NC,NX/NR,NY/NS,NZ
D min/max/mean-0.1290.2030.000
Annotation DetailsElectron cryo-microscopy structure of LbuCas13a-crRNA binary complex
Supplement
Images
Images
Sample
NameLbuCas13a-crRNA binary complex
Number of Components3
Component #1: protein - LbuCas13a-crRNA binary complex
Scientific nameLbuCas13a-crRNA binary complex
Scientific Name of SpeciesLeptotrichia buccalis
NCBI taxonomy523794
StrainATCC 14201
Recombinant expressionNo
Engineered SourceNCBI taxonomy: 562
Expression system: Escherichia coli
Component #2: protein - A type VI-A CRISPR-Cas RNA-guided RNA ribonuclease, Cas13a
Scientific nameA type VI-A CRISPR-Cas RNA-guided RNA ribonuclease, Cas13a
Theoretical Mass0.138555156 MDa
Recombinant expressionNo
Engineered SourceNCBI taxonomy: 523794
Expression system: Leptotrichia buccalis (strain ATCC 14201 / DSM 1135 / JCM 12969 / NCTC 10249 / C-1013-b)
Exp System Strain: ATCC 14201 / DSM 1135 / JCM 12969 / NCTC 10249 / C-1013-b
Component #3: nucleic-acid - RNA (59-MER)
Scientific nameRNA (59-MER)
Theoretical Mass0.018869348 MDa
SyntheticNo
SequenceGGACCACCCCAAAAAUGAAGGGGACUAAAACACAAAUCUAUCUGAAUAAA CUCUUCUUC
ClassRNA
StructureOTHER
Experiment
Sample Preparation
Specimen Stateparticle
BufferpH: 7.5
Vitrification
Cryogen NameETHANE
Imaging
MicroscopeFEI TITAN KRIOS
Electron Gun
Electron SourceFIELD EMISSION GUN
Accelerating Voltage300 kV
Electron Dose60 e/A**2
Illumination ModeFLOOD BEAM
Lens
Imaging ModeBRIGHT FIELD
Specimen Holder
ModelOTHER
Camera
DetectorGATAN K2 (4k x 4k)
Processing
Methodsingle particle reconstruction
3D reconstruction
Resolution By Author3.2 A
Resolution MethodFSC 0.143 CUT-OFF
Single Particle
Number of Projections238758
Atomic Model Fitting
Fitted Coordinate
PDB entry ID
Download
Data from EMDB
Header (meta data in XML format)emd-6777-v19.xml (6.6 KB)
emd-6777-v20.xml (10.1 KB)
emd-6777.xml (6.6 KB)
Map dataemd_6777.map.gz (3.4 MB)
Imagesemd_6777.png (271.4 KB)
FTP directoryftp://ftp.pdbj.org/pub/emdb/structures/EMD-6777
Movie files
movie #1
.mp4 (H.264/MPEG-4 AVC format), 3.5 MB
.webm (WebM/VP8 format), 6.4 MB
Session file for UCSF-Chimera, 26.8 KB
movie #2
.mp4 (H.264/MPEG-4 AVC format), 3.3 MB
.webm (WebM/VP8 format), 6.4 MB
Session file for UCSF-Chimera, 26.8 KB
movie #3
.mp4 (H.264/MPEG-4 AVC format), 3.7 MB
.webm (WebM/VP8 format), 7.1 MB
Session file for UCSF-Chimera, 980.3 KB