eF-site ID 5e54-AB PDB Code 5e54 Chain A, B click to enlarge Title Two apo structures of the adenine riboswitch aptamer domain determined using an X-ray free electron laser Classification RNA Compound Vibrio vulnificus strain 93U204 chromosome II, adenine riboswitch aptamer domain Source (5E54) Sequence A:  GGGAAGAUAUAAUCCUAAUGAUAUGGUUUGGGAGUUUCUA CCAAGAGCCUUAAACUCUUGAUUAU B:  GGGAAGAUAUAAUCCUAAUGAUAUGGUUUGGGAGUUUCUA CCAAGAGCCUUAAACUCUUGAUUAUCUU Description Functional site 1) chain A residue 37 type sequence G description binding site for residue MG A 101 source : AC1 2) chain B residue 68 type sequence U description binding site for residue MG A 101 source : AC1 3) chain A residue 51 type sequence U description binding site for residue MG A 102 source : AC2 4) chain A residue 52 type sequence A description binding site for residue MG A 102 source : AC2 5) chain A residue 22 type sequence U description binding site for residue MG A 103 source : AC3 6) chain A residue 23 type sequence A description binding site for residue MG A 103 source : AC3 7) chain A residue 48 type sequence U description binding site for residue MG A 103 source : AC3 8) chain B residue 24 type sequence A description binding site for residue MG B 101 source : AC4

Display surface Download Links