eF-site ID 4un8-BCEFHI
PDB Code 4un8
Chain B, C, E, F, H, I

click to enlarge
Title THE CRYSTAL STRUCTURE OF I-DMOI IN COMPLEX WITH ITS TARGET DNA AT 1H INCUBATION IN 5MM MN (STATE 2)
Classification HYDROLASE/DNA
Compound HOMING ENDONUCLEASE I-DMOI
Source Desulfurococcus mobilis (4UN8)
Sequence B:  GCCTTGCCGGGTAAGTTCCGGCGCG
C:  CGCGCCGGAACTTACCCGGCAAGGC
E:  GCCTTGCCGGGTAAGTTCCGGCGCG
F:  CGCGCCGGAACTTACCCGGCAAGGC
H:  GCCTTGCCGGGTAAGTTCCGGCGCG
I:  CGCGCCGGAACTTACCCGGCAAGGC
Description (1)  HOMING ENDONUCLEASE I-DMOI (E.C.3.1.-.-)


Functional site

1) chain B
residue 14
type
ligand
sequence A
description BINDING SITE FOR RESIDUE MN A 1188
source : AC1

2) chain C
residue 16
type
ligand
sequence C
description BINDING SITE FOR RESIDUE MN A 1188
source : AC1

3) chain B
residue 15
type
ligand
sequence G
description BINDING SITE FOR RESIDUE MN A 1189
source : AC2

4) chain C
residue 15
type
ligand
sequence C
description BINDING SITE FOR RESIDUE MN A 1189
source : AC2

5) chain E
residue 14
type
ligand
sequence A
description BINDING SITE FOR RESIDUE MN D 1197
source : AC3

6) chain F
residue 16
type
ligand
sequence C
description BINDING SITE FOR RESIDUE MN D 1197
source : AC3

7) chain E
residue 15
type
ligand
sequence G
description BINDING SITE FOR RESIDUE MN D 1198
source : AC4

8) chain F
residue 15
type
ligand
sequence C
description BINDING SITE FOR RESIDUE MN D 1198
source : AC4

9) chain H
residue 15
type
ligand
sequence G
description BINDING SITE FOR RESIDUE MN G 1182
source : AC5

10) chain I
residue 15
type
ligand
sequence C
description BINDING SITE FOR RESIDUE MN G 1182
source : AC5

11) chain H
residue 14
type
ligand
sequence A
description BINDING SITE FOR RESIDUE MN G 1183
source : AC6

12) chain I
residue 16
type
ligand
sequence C
description BINDING SITE FOR RESIDUE MN G 1183
source : AC6


Display surface

Download
Links