eF-site ID 3s8u-A
PDB Code 3s8u
Chain A

click to enlarge
Title Crystal structure of a 2-azido-adenine-modified RNA
Classification RNA
Compound Ecoli 23 S rRNA Sarcin Ricin loop
Source (3S8U)
Sequence A:  UGCUCCUAGUACGAGAGGACCGGXGUG
Description (1)  Ecoli 23 S rRNA Sarcin Ricin loop

Display surface

Download
Links