eF-site ID 2hw8-B PDB Code 2hw8 Chain B click to enlarge Title Structure of ribosomal protein L1-mRNA complex at 2.1 resolution. Classification STRUCTURAL PROTEIN/RNA Compound 36-MER Source Thermus thermophilus (2HW8) Sequence B:  GGGGUGAAGGAGGCUUCGGCCGCGAAACUUCACCCC Description Functional site 1) chain B residue 30 type sequence U description BINDING SITE FOR RESIDUE K A 229 source : AC1 2) chain B residue 31 type sequence U description BINDING SITE FOR RESIDUE K A 229 source : AC1

Display surface Download Links