eF-site ID 2gku_12-A
PDB Code 2gku
Model 12
Chain A

click to enlarge
Title Monomeric human telomere DNA tetraplex with 3+1 strand fold topology, two edgewise loops and double-chain reversal loop, NMR, 12 structures
Classification DNA
Compound Human telomere DNA
Source (2GKU)
Sequence A:  TTGGGTTAGGGTTAGGGTTAGGGA
Description (1)  5'-D(*TP*TP*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*A)-3'

Display surface

Download
Links