eF-site ID 2be0-AB PDB Code 2be0 Chain A, B click to enlarge Title Complex Between Paromomycin Derivative JS5-39 and the 16S-Rrna A-Site. Classification RNA/antibiotic Compound 5'-R(*CP*GP*CP*GP*UP*CP*AP*CP*AP*CP*CP*GP*GP*UP*GP*AP*AP*GP*UP*CP*GP*C)-3' Source (2BE0) Sequence A:  GCGUCACACCGGUGAAGUCGC B:  GCGUCACACCGGUGAAGUCGC Description Functional site 1) chain A residue 13 type sequence U description BINDING SITE FOR RESIDUE JS5 A 50 source : AC1 2) chain A residue 14 type sequence G description BINDING SITE FOR RESIDUE JS5 A 50 source : AC1 3) chain A residue 15 type sequence A description BINDING SITE FOR RESIDUE JS5 A 50 source : AC1 4) chain A residue 16 type sequence A description BINDING SITE FOR RESIDUE JS5 A 50 source : AC1 5) chain A residue 17 type sequence G description BINDING SITE FOR RESIDUE JS5 A 50 source : AC1 6) chain A residue 18 type sequence U description BINDING SITE FOR RESIDUE JS5 A 50 source : AC1 7) chain B residue 23 type sequence C description BINDING SITE FOR RESIDUE JS5 A 50 source : AC1 8) chain B residue 25 type sequence U description BINDING SITE FOR RESIDUE JS5 A 50 source : AC1 9) chain B residue 26 type sequence C description BINDING SITE FOR RESIDUE JS5 A 50 source : AC1 10) chain B residue 27 type sequence A description BINDING SITE FOR RESIDUE JS5 A 50 source : AC1 11) chain B residue 29 type sequence A description BINDING SITE FOR RESIDUE JS5 A 50 source : AC1 12) chain A residue 3 type sequence G description BINDING SITE FOR RESIDUE JS5 B 51 source : AC2 13) chain A residue 4 type sequence U description BINDING SITE FOR RESIDUE JS5 B 51 source : AC2 14) chain A residue 5 type sequence C description BINDING SITE FOR RESIDUE JS5 B 51 source : AC2 15) chain A residue 6 type sequence A description BINDING SITE FOR RESIDUE JS5 B 51 source : AC2 16) chain A residue 8 type sequence A description BINDING SITE FOR RESIDUE JS5 B 51 source : AC2 17) chain B residue 34 type sequence U description BINDING SITE FOR RESIDUE JS5 B 51 source : AC2 18) chain B residue 35 type sequence G description BINDING SITE FOR RESIDUE JS5 B 51 source : AC2 19) chain B residue 36 type sequence A description BINDING SITE FOR RESIDUE JS5 B 51 source : AC2 20) chain B residue 37 type sequence A description BINDING SITE FOR RESIDUE JS5 B 51 source : AC2 21) chain B residue 38 type sequence G description BINDING SITE FOR RESIDUE JS5 B 51 source : AC2 22) chain B residue 39 type sequence U description BINDING SITE FOR RESIDUE JS5 B 51 source : AC2

Display surface Download Links