eF-site ID 1rr8-AB PDB Code 1rr8 Chain A, B click to enlarge Title Structural Mechanisms of Camptothecin Resistance by Mutations in Human Topoisomerase I Classification ISOMERASE/DNA Compound 5'-D(*AP*AP*AP*AP*AP*GP*AP*CP*TP*T*GP*GP*AP*AP*AP*AP*AP*TP*TP*TP*TP*T)-3' Source null (1RR8) Sequence A:  AAAAAGACTTGGAAAAATTTTT B:  AAAAATTTTTCCAAGTCTTTTT Description Functional site 1) chain A residue 10 type sequence T description BINDING SITE FOR RESIDUE TTG A 1991 source : AC1 2) chain A residue 11 type sequence G description BINDING SITE FOR RESIDUE TTG A 1991 source : AC1 3) chain A residue 12 type sequence G description BINDING SITE FOR RESIDUE TTG A 1991 source : AC1 4) chain B residue 112 type sequence C description BINDING SITE FOR RESIDUE TTG A 1991 source : AC1 5) chain B residue 113 type sequence A description BINDING SITE FOR RESIDUE TTG A 1991 source : AC1 6) chain A residue 10 type sequence T description BINDING SITE FOR RESIDUE TTC A 100 source : AC2 7) chain A residue 11 type sequence G description BINDING SITE FOR RESIDUE TTC A 100 source : AC2 8) chain A residue 12 type sequence G description BINDING SITE FOR RESIDUE TTC A 100 source : AC2 9) chain B residue 112 type sequence C description BINDING SITE FOR RESIDUE TTC A 100 source : AC2 10) chain B residue 113 type sequence A description BINDING SITE FOR RESIDUE TTC A 100 source : AC2

Display surface Download Links