eF-site ID 1q96-ABC PDB Code 1q96 Chain A, B, C click to enlarge Title Crystal structure of a mutant of the sarcin/ricin domain from rat 28S rRNA Classification RNA Compound sarcin/ricin 28S rRNA Source (430D_A) Sequence A:  GGUGCUCAGUAUGAGAAGAACCGCACC B:  GGUGCUCAGUAUGAGAAGAACCGCACC C:  GGUGCUCAGUAUGAGAAGAACCGCACC Description Functional site 1) chain A residue 15 type sequence A description BINDING SITE FOR RESIDUE SO4 C 311 source : AC1 2) chain A residue 16 type sequence G description BINDING SITE FOR RESIDUE SO4 C 311 source : AC1 3) chain A residue 17 type sequence A description BINDING SITE FOR RESIDUE SO4 C 311 source : AC1 4) chain C residue 2 type sequence G description BINDING SITE FOR RESIDUE SO4 C 311 source : AC1 5) chain C residue 3 type sequence G description BINDING SITE FOR RESIDUE SO4 C 311 source : AC1 6) chain A residue 2 type sequence G description BINDING SITE FOR RESIDUE SO4 A 312 source : AC2 7) chain A residue 27 type sequence C description BINDING SITE FOR RESIDUE SO4 A 312 source : AC2 8) chain A residue 28 type sequence C description BINDING SITE FOR RESIDUE SO4 A 312 source : AC2 9) chain B residue 16 type sequence G description BINDING SITE FOR RESIDUE SO4 B 313 source : AC3 10) chain B residue 17 type sequence A description BINDING SITE FOR RESIDUE SO4 B 313 source : AC3 11) chain A residue 23 type sequence C description BINDING SITE FOR RESIDUE SO4 A 314 source : AC4 12) chain A residue 24 type sequence G description BINDING SITE FOR RESIDUE SO4 A 314 source : AC4

Display surface Download Links