Sequence (fasta): 5y85Download

>5Y85A:RNA (5'-R(P*AP*CP*CP*CP*GP*CP*AP*AP*GP*GP*CP*CP*GP*AP*CP*GP*GP*C)-3')
ACCCGCAAGGCCGACGGC
>5Y85C:RNA (5'-R(P*AP*CP*CP*CP*GP*CP*AP*AP*GP*GP*CP*CP*GP*AP*CP*GP*GP*C)-3')
ACCCGCAAGGCCGACGGC
>5Y85B:DNA/RNA (50-MER)
GCCGCCGCUGGUGCAAGUCCAGCCACGCUUCGGCGUGGGCGCUCAUGGGU
>5Y85D:DNA/RNA (50-MER)
GCCGCCGCUGGUGCAAGUCCAGCCACGCUUCGGCGUGGGCGCUCAUGGGU