Sequence (fasta): 3s7cDownload

>3S7CA:Ecoli 23 S rRNA Sarcin Ricin loop
UGCXCCUAGUACGAGAGGACCGGAGUG