Author results

6R9R
  • Download 6r9r
  • View 6r9r
Molmil generated image of 6r9r
CRYSTAL STRUCTURE OF CSX1 IN COMPLEX WITH CYCLIC OLIGOADENYLATE COA4 CONFORMATION 2
Descriptor:DNA (5'-R(P*AP*AP*AP*A)-3'), CRISPR-associated (Cas) DxTHG family
Authors:Molina, R., Montoya, G., Sofos, N., Stella, S.
Deposit date:2019-04-03
Release date:2019-10-02
Method:X-RAY DIFFRACTION (2.7 Å)
Cite:Structure of Csx1-cOA4complex reveals the basis of RNA decay in Type III-B CRISPR-Cas.
Nat Commun, 10, 2019
6R7B
  • Download 6r7b
  • View 6r7b
Molmil generated image of 6r7b
CRYSTAL STRUCTURE OF CSX1 IN COMPLEX WITH CYCLIC OLIGOADENYLATE COA4 CONFORMATION 1
Descriptor:CRISPR-associated (Cas) DxTHG family, RNA (5'-R(P*AP*AP*AP*A)-3')
Authors:Molina, R., Montoya, G., Sofos, N., Stella, S.
Deposit date:2019-03-28
Release date:2019-10-02
Method:X-RAY DIFFRACTION (3.12 Å)
Cite:Structure of Csx1-cOA4complex reveals the basis of RNA decay in Type III-B CRISPR-Cas.
Nat Commun, 10, 2019
6QZT
  • Download 6qzt
  • View 6qzt
Molmil generated image of 6qzt
CRYSTAL STRUCTURE OF CSX1 FROM SULFOLOBUS ISLANDICUS ORTHORHOMBIC FORM
Descriptor:CRISPR-associated (Cas) DxTHG family
Authors:Molina, R., Montoya, G., Sofos, N., Stella, S.
Deposit date:2019-03-12
Release date:2019-10-02
Method:X-RAY DIFFRACTION (2.93 Å)
Cite:Structure of Csx1-cOA4complex reveals the basis of RNA decay in Type III-B CRISPR-Cas.
Nat Commun, 10, 2019
6GTG
  • Download 6gtg
  • View 6gtg
Molmil generated image of 6gtg
TRANSITION STATE STRUCTURE OF CPF1(CAS12A) I4 CONFORMATION
Descriptor:CRISPR-associated endonuclease Cas12a, RNA (40-MER), DNA (32-MER), ...
Authors:Mesa, P., Montoya, G., Stella, S.
Deposit date:2018-06-18
Release date:2018-12-19
Last modified:2019-11-06
Method:ELECTRON MICROSCOPY (3.27 Å)
Cite:Conformational Activation Promotes CRISPR-Cas12a Catalysis and Resetting of the Endonuclease Activity.
Cell, 175, 2018
6GTF
  • Download 6gtf
  • View 6gtf
Molmil generated image of 6gtf
TRANSIENT STATE STRUCTURE OF CRISPR-CPF1 (CAS12A) I5 CONFORMATION
Descriptor:CRISPR-associated endonuclease Cas12a, RNA (29-MER), DNA (5'-D(P*AP*TP*GP*AP*CP*TP*TP*CP*TP*CP*TP*AP*AP*CP*AP*AP*GP*CP*TP*CP*G)-3'), ...
Authors:Montoya, G., Mesa, P., Stella, S.
Deposit date:2018-06-18
Release date:2018-12-19
Last modified:2019-11-06
Method:ELECTRON MICROSCOPY (3.63 Å)
Cite:Conformational Activation Promotes CRISPR-Cas12a Catalysis and Resetting of the Endonuclease Activity.
Cell, 175, 2018
6GTE
  • Download 6gte
  • View 6gte
Molmil generated image of 6gte
TRANSIENT STATE STRUCTURE OF CRISPR-CPF1 (CAS12A) I3 CONFORMATION
Descriptor:CRISPR-associated endonuclease Cas12a, RNA (29-MER), DNA (5'-D(P*AP*TP*GP*AP*CP*TP*TP*CP*TP*CP*TP*AP*AP*CP*AP*AP*GP*CP*TP*CP*G)-3'), ...
Authors:Montoya, G., Mesa, P., Stella, S.
Deposit date:2018-06-18
Release date:2018-12-19
Last modified:2019-11-06
Method:ELECTRON MICROSCOPY (4.07 Å)
Cite:Conformational Activation Promotes CRISPR-Cas12a Catalysis and Resetting of the Endonuclease Activity.
Cell, 175, 2018
6GTD
  • Download 6gtd
  • View 6gtd
Molmil generated image of 6gtd
TRANSIENT STATE STRUCTURE OF CRISPR-CPF1 (CAS12A) I2 CONFORMATION
Descriptor:CRISPR-associated endonuclease Cas12a, RNA (28-MER), DNA (5'-D(P*TP*GP*AP*CP*TP*TP*CP*TP*CP*TP*AP*AP*CP*AP*AP*GP*CP*TP*CP*G)-3'), ...
Authors:Montoya, G., Mesa, P.
Deposit date:2018-06-18
Release date:2018-12-19
Last modified:2019-11-06
Method:ELECTRON MICROSCOPY (4.24 Å)
Cite:Conformational Activation Promotes CRISPR-Cas12a Catalysis and Resetting of the Endonuclease Activity.
Cell, 175, 2018
6GTC
  • Download 6gtc
  • View 6gtc
Molmil generated image of 6gtc
TRANSITION STATE STRUCTURE OF CPF1(CAS12A) I1 CONFORMATION
Descriptor:CRISPR-associated endonuclease Cas12a, RNA (28-MER), DNA (5'-D(P*TP*GP*AP*CP*TP*TP*CP*TP*CP*TP*AP*AP*CP*AP*AP*GP*CP*TP*CP*G)-3'), ...
Authors:Mesa, P., Montoya, G.
Deposit date:2018-06-18
Release date:2018-12-19
Last modified:2019-11-06
Method:ELECTRON MICROSCOPY (3.91 Å)
Cite:Conformational Activation Promotes CRISPR-Cas12a Catalysis and Resetting of the Endonuclease Activity.
Cell, 175, 2018
6DTD
  • Download 6dtd
  • View 6dtd
Molmil generated image of 6dtd
HIGH-RESOLUTION CRYSTAL STRUCTURE OF CAS13B FROM PREVOTELLA BUCCAE
Descriptor:nuclease, RNA (37-MER), CITRIC ACID, ...
Authors:Slaymaker, I.M.S., Zhang, F.Z.
Deposit date:2018-06-15
Release date:2019-02-20
Last modified:2019-09-11
Method:X-RAY DIFFRACTION (1.65 Å)
Cite:High-Resolution Structure of Cas13b and Biochemical Characterization of RNA Targeting and Cleavage.
Cell Rep, 26, 2019
5MGA
  • Download 5mga
  • View 5mga
Molmil generated image of 5mga
STRUCTURE OF THE CPF1 ENDONUCLEASE R-LOOP COMPLEX AFTER DNA CLEAVAGE
Descriptor:CRISPR-associated endonuclease Cpf1, RNA (40-MER), DNA (26-MER), ...
Authors:Montoya, G., Stella, S.
Deposit date:2016-11-21
Release date:2017-06-21
Last modified:2018-10-24
Method:X-RAY DIFFRACTION (3 Å)
Cite:Structure of the Cpf1 endonuclease R-loop complex after target DNA cleavage.
Nature, 546, 2017
5E3O
  • Download 5e3o
  • View 5e3o
Molmil generated image of 5e3o
CRYSTAL STRUCTURE OF FIS BOUND TO 27BP DNA F32 (AAATTTGGAGGAATTTTCTCCAAATTT)
Descriptor:DNA-binding protein Fis, DNA (27-MER)
Authors:Hancock, S.P., Cascio, D., Johnson, R.C.
Deposit date:2015-10-03
Release date:2016-03-09
Last modified:2016-03-23
Method:X-RAY DIFFRACTION (2.78 Å)
Cite:DNA Sequence Determinants Controlling Affinity, Stability and Shape of DNA Complexes Bound by the Nucleoid Protein Fis.
Plos One, 11, 2016
5E3N
  • Download 5e3n
  • View 5e3n
Molmil generated image of 5e3n
CRYSTAL STRUCTURE OF FIS BOUND TO 27BP DNA F31 (AAATTTGTAGGAATTTTCTGCAAATTT)
Descriptor:DNA-binding protein Fis, DNA (27-MER)
Authors:Hancock, S.P., Cascio, D., Johnson, R.C.
Deposit date:2015-10-03
Release date:2016-03-09
Last modified:2016-03-23
Method:X-RAY DIFFRACTION (2.66 Å)
Cite:DNA Sequence Determinants Controlling Affinity, Stability and Shape of DNA Complexes Bound by the Nucleoid Protein Fis.
Plos One, 11, 2016
5E3M
  • Download 5e3m
  • View 5e3m
Molmil generated image of 5e3m
CRYSTAL STRUCTURE OF FIS BOUND TO 27BP DNA F35 (AAATTAGTTTGAATCTCGAGCTAATTT)
Descriptor:DNA-binding protein Fis, DNA (27-MER)
Authors:Stella, S., Hancock, S.P., Cascio, D., Johnson, R.C.
Deposit date:2015-10-03
Release date:2016-03-09
Last modified:2016-03-23
Method:X-RAY DIFFRACTION (2.886 Å)
Cite:DNA Sequence Determinants Controlling Affinity, Stability and Shape of DNA Complexes Bound by the Nucleoid Protein Fis.
Plos One, 11, 2016
5E3L
  • Download 5e3l
  • View 5e3l
Molmil generated image of 5e3l
CRYSTAL STRUCTURE OF FIS BOUND TO 27BP DNA F1-8G (AAATTGGTTTGAATTTTGAGCCAATTT)
Descriptor:DNA-binding protein Fis, DNA (27-MER)
Authors:Hancock, S.P., Cascio, D., Johnson, R.C.
Deposit date:2015-10-03
Release date:2016-03-23
Method:X-RAY DIFFRACTION (2.66 Å)
Cite:DNA Sequence Determinants Controlling Affinity, Stability and Shape of DNA Complexes Bound by the Nucleoid Protein Fis.
Plos One, 11, 2016
5DTD
  • Download 5dtd
  • View 5dtd
Molmil generated image of 5dtd
CRYSTAL STRUCTURE OF FIS BOUND TO 27BP DNA F1-8C (AAATTCGTTTGAATTTTGAGCGAATTT)
Descriptor:DNA-binding protein Fis, DNA (27-MER)
Authors:Hancock, S.P., Cascio, D., Johnson, R.C.
Deposit date:2015-09-17
Release date:2016-03-09
Last modified:2016-03-23
Method:X-RAY DIFFRACTION (2.642 Å)
Cite:DNA Sequence Determinants Controlling Affinity, Stability and Shape of DNA Complexes Bound by the Nucleoid Protein Fis.
Plos One, 11, 2016
5DS9
  • Download 5ds9
  • View 5ds9
Molmil generated image of 5ds9
CRYSTAL STRUCTURE OF FIS BOUND TO 27BP DNA F1-8A (AAATTAGTTTGAATTTTGAGCTAATTT)
Descriptor:DNA-binding protein Fis, DNA (27-MER)
Authors:Hancock, S.P., Cascio, D., Johnson, R.C.
Deposit date:2015-09-17
Release date:2016-07-27
Method:X-RAY DIFFRACTION (2.561 Å)
Cite:DNA Sequence Determinants Controlling Affinity, Stability and Shape of DNA Complexes Bound by the Nucleoid Protein Fis.
Plos One, 11, 2016
4UT0
  • Download 4ut0
  • View 4ut0
Molmil generated image of 4ut0
THE CRYSTAL STRUCTURE OF I-DMOI IN COMPLEX WITH ITS TARGET DNA AT 10 DAYS INCUBATION IN 5MM MN (STATE 7)
Descriptor:HOMING ENDONUCLEASE I-DMOI, 5'-D(*GP*CP*CP*TP*TP*GP*CP*CP*GP*GP*GP*TP*AP*AP)-3', 5'-D(*GP*TP*TP*CP*CP*GP*GP*CP*GP*CP*GP)-3', ...
Authors:Molina, R., Stella, S., Redondo, P., Gomez, H., Marcaida, M.J., Orozco, M., Prieto, J., Montoya, G.
Deposit date:2014-07-17
Release date:2014-12-17
Last modified:2015-01-21
Method:X-RAY DIFFRACTION (2.4 Å)
Cite:Visualizing Phosphodiester-Bond Hydrolysis by an Endonuclease.
Nat.Struct.Mol.Biol., 22, 2015
4UNC
  • Download 4unc
  • View 4unc
Molmil generated image of 4unc
THE CRYSTAL STRUCTURE OF I-DMOI IN COMPLEX WITH ITS TARGET DNA AT 8 DAYS INCUBATION IN 5MM MN (STATE 6)
Descriptor:HOMING ENDONUCLEASE I-DMOI, 5'-D(*GP*CP*CP*TP*TP*GP*CP*CP*GP*GP*GP*TP*AP*A)-3', 5'-D(*CP*GP*CP*GP*CP*CP*GP*GP*AP*AP*CP*TP*TP*AP*C)-3', ...
Authors:Molina, R., Stella, S., Redondo, P., Gomez, H., Marcaida, M.J., Orozco, M., Prieto, J., Montoya, G.
Deposit date:2014-05-26
Release date:2014-12-17
Last modified:2015-01-21
Method:X-RAY DIFFRACTION (2.3 Å)
Cite:Visualizing Phosphodiester-Bond Hydrolysis by an Endonuclease.
Nat.Struct.Mol.Biol., 22, 2015
4UNB
  • Download 4unb
  • View 4unb
Molmil generated image of 4unb
THE CRYSTAL STRUCTURE OF I-DMOI IN COMPLEX WITH ITS TARGET DNA AT 6 DAYS INCUBATION IN 5MM MN (STATE 5)
Descriptor:HOMING ENDONUCLEASE I-DMOI, 5'-D(*GP*CP*CP*TP*TP*GP*CP*CP*GP*GP*GP*TP*AP*A)-3', 5'-D(*CP*GP*CP*GP*CP*CP*GP*GP*AP*AP*CP*TP*TP*AP*C)-3', ...
Authors:Molina, R., Stella, S., Redondo, P., Gomez, H., Marcaida, M.J., Orozco, M., Prieto, J., Montoya, G.
Deposit date:2014-05-26
Release date:2014-12-17
Last modified:2015-01-21
Method:X-RAY DIFFRACTION (2.55 Å)
Cite:Visualizing Phosphodiester-Bond Hydrolysis by an Endonuclease.
Nat.Struct.Mol.Biol., 22, 2015
4UNA
  • Download 4una
  • View 4una
Molmil generated image of 4una
THE CRYSTAL STRUCTURE OF I-DMOI IN COMPLEX WITH ITS TARGET DNA AT 2 DAYS INCUBATION IN 5MM MN (STATE 4)
Descriptor:HOMING ENDONUCLEASE I-DMOI, 25MER, 5'-D(*CP*GP*CP*GP*CP*CP*GP*GP*AP*AP*CP*TP*TP*AP*C)-3', ...
Authors:Molina, R., Stella, S., Redondo, P., Gomez, H., Marcaida, M.J., Orozco, M., Prieto, J., Montoya, G.
Deposit date:2014-05-26
Release date:2014-12-17
Last modified:2015-01-21
Method:X-RAY DIFFRACTION (2.3 Å)
Cite:Visualizing Phosphodiester-Bond Hydrolysis by an Endonuclease.
Nat.Struct.Mol.Biol., 22, 2015
4UN9
  • Download 4un9
  • View 4un9
Molmil generated image of 4un9
THE CRYSTAL STRUCTURE OF I-DMOI IN COMPLEX WITH ITS TARGET DNA AT 8H INCUBATION IN 5MM MN (STATE 3)
Descriptor:HOMING ENDONUCLEASE I-DMOI, 25MER, MANGANESE (II) ION
Authors:Molina, R., Stella, S., Redondo, P., Gomez, H., Marcaida, M.J., Orozco, M., Prieto, J., Montoya, G.
Deposit date:2014-05-26
Release date:2015-01-14
Last modified:2015-07-22
Method:X-RAY DIFFRACTION (2.734 Å)
Cite:Visualizing Phosphodiester-Bond Hydrolysis by an Endonuclease.
Nat.Struct.Mol.Biol., 22, 2015
4UN8
  • Download 4un8
  • View 4un8
Molmil generated image of 4un8
THE CRYSTAL STRUCTURE OF I-DMOI IN COMPLEX WITH ITS TARGET DNA AT 1H INCUBATION IN 5MM MN (STATE 2)
Descriptor:HOMING ENDONUCLEASE I-DMOI, 25MER, MANGANESE (II) ION
Authors:Molina, R., Stella, S., Redondo, P., Gomez, H., Marcaida, M.J., Orozco, M., Prieto, J., Montoya, G.
Deposit date:2014-05-26
Release date:2014-12-17
Last modified:2015-01-21
Method:X-RAY DIFFRACTION (2.6 Å)
Cite:Visualizing Phosphodiester-Bond Hydrolysis by an Endonuclease.
Nat.Struct.Mol.Biol., 22, 2015
4UN7
  • Download 4un7
  • View 4un7
Molmil generated image of 4un7
THE CRYSTAL STRUCTURE OF I-DMOI IN COMPLEX WITH ITS TARGET DNA BEFORE INCUBATION IN 5MM MN (STATE 1)
Descriptor:HOMING ENDONUCLEASE I-DMOI, 25MER, ZINC ION
Authors:Molina, R., Stella, S., Redondo, P., Gomez, H., Marcaida, M.J., Orozco, M., Prieto, J., Montoya, G.
Deposit date:2014-05-26
Release date:2014-12-03
Last modified:2015-01-21
Method:X-RAY DIFFRACTION (2.7 Å)
Cite:Visualizing Phosphodiester-Bond Hydrolysis by an Endonuclease.
Nat.Struct.Mol.Biol., 22, 2015
4D6O
  • Download 4d6o
  • View 4d6o
Molmil generated image of 4d6o
THE CRYSTAL STRUCTURE OF I-DMOI IN COMPLEX WITH ITS TARGET DNA AT 1H INCUBATION IN 5MM MG (STATE 2)
Descriptor:HOMING ENDONUCLEASE I-DMOI, 25MER, MAGNESIUM ION, ...
Authors:Molina, R., Stella, S., Redondo, P., Gomez, H., Marcaida, M.J., Orozco, M., Prieto, J., Montoya, G.
Deposit date:2014-11-13
Release date:2014-12-17
Last modified:2017-08-23
Method:X-RAY DIFFRACTION (2.2 Å)
Cite:Visualizing Phosphodiester-Bond Hydrolysis by an Endonuclease.
Nat.Struct.Mol.Biol., 22, 2015
4D6N
  • Download 4d6n
  • View 4d6n
Molmil generated image of 4d6n
THE CRYSTAL STRUCTURE OF I-DMOI IN COMPLEX WITH ITS TARGET DNA AT 10 DAYS INCUBATION IN 5MM MG (STATE 7)
Descriptor:HOMING ENDONUCLEASE I-DMOI, 5'-D(*DGP*CP*CP*TP*TP*GP*CP*CP*GP*GP*GP*TP*AP*DAP)-3', 5'-D(*DGP*TP*TP*CP*CP*GP*GP*CP*GP*CP*GP)-3', ...
Authors:Molina, R., Stella, S., Redondo, P., Gomez, H., Marcaida, M.J., Orozco, M., Prieto, J., Montoya, G.
Deposit date:2014-11-13
Release date:2014-12-17
Last modified:2017-08-23
Method:X-RAY DIFFRACTION (2.35 Å)
Cite:Visualizing Phosphodiester-Bond Hydrolysis by an Endonuclease.
Nat.Struct.Mol.Biol., 22, 2015
<12>