Author results

2YPF
  • Download 2ypf
  • View 2ypf
Molmil generated image of 2ypf
STRUCTURE OF THE AVRBS3-DNA COMPLEX PROVIDES NEW INSIGHTS INTO THE INITIAL THYMINE-RECOGNITION MECHANISM
Descriptor:AVRBS3, 5'-D(*TP*TP*TP*AP*TP*AP*TP*AP*AP*AP*CP*CP*TP*AP *AP*CP*CP*CP*TP*CP*TP*AP)-3', 5'-D(*TP*AP*GP*AP*GP*GP*GP*TP*TP*AP*GP*GP*TP*TP *TP*AP*TP*AP*TP*AP*AP)-3'
Authors:Stella, S., Molina, R., Yefimenko, I., Prieto, J., Silva, G.H., Bertonati, C., Juillerat, A., Duchateau, P., Montoya, G.
Deposit date:2012-10-30
Release date:2013-08-28
Last modified:2013-09-11
Method:X-RAY DIFFRACTION (2.55 Å)
Cite:Structure of the Avrbs3-DNA Complex Provides New Insights Into the Initial Thymine-Recognition Mechanism
Acta Crystallogr.,Sect.D, 69, 2013
3IV5
  • Download 3iv5
  • View 3iv5
Molmil generated image of 3iv5
CRYSTAL STRUCTURE OF FIS BOUND TO 27 BP OPTIMAL BINDING SEQUENCE F1
Descriptor:DNA-binding protein fis, DNA (27-MER)
Authors:Stella, S., Cascio, D., Johnson, R.C.
Deposit date:2009-08-31
Release date:2010-04-28
Last modified:2017-11-01
Method:X-RAY DIFFRACTION (2.9 Å)
Cite:The shape of the DNA minor groove directs binding by the DNA-bending protein Fis.
Genes Dev., 24, 2010
3JR9
  • Download 3jr9
  • View 3jr9
Molmil generated image of 3jr9
CRYSTAL STRUCTURE OF FIS BOUND TO 27 BP OPTIMAL BINDING SEQUENCE F2
Descriptor:DNA-binding protein fis, DNA (27-MER)
Authors:Stella, S., Cascio, D., Johnson, R.C.
Deposit date:2009-09-08
Release date:2010-04-28
Last modified:2017-11-01
Method:X-RAY DIFFRACTION (2.9 Å)
Cite:The shape of the DNA minor groove directs binding by the DNA-bending protein Fis.
Genes Dev., 24, 2010
3JRA
  • Download 3jra
  • View 3jra
Molmil generated image of 3jra
CRYSTAL STRUCTURE OF FIS BOUND TO 27BP NON CONSENSUS SEQUENCE DNA F6
Descriptor:DNA-binding protein fis, DNA (27-MER)
Authors:Stella, S., Cascio, D., Johnson, R.C.
Deposit date:2009-09-08
Release date:2010-04-28
Last modified:2017-11-01
Method:X-RAY DIFFRACTION (3.11 Å)
Cite:The shape of the DNA minor groove directs binding by the DNA-bending protein Fis.
Genes Dev., 24, 2010
3JRB
  • Download 3jrb
  • View 3jrb
Molmil generated image of 3jrb
CRYSTAL STRUCTURE OF FIS BOUND TO 27 BP DNA F24 CONTAINING T-TRACT AT CENTER
Descriptor:DNA-binding protein fis, DNA (27-MER)
Authors:Stella, S., Cascio, D., Johnson, R.C.
Deposit date:2009-09-08
Release date:2010-04-28
Last modified:2017-11-01
Method:X-RAY DIFFRACTION (3.1 Å)
Cite:The shape of the DNA minor groove directs binding by the DNA-bending protein Fis.
Genes Dev., 24, 2010
3JRC
  • Download 3jrc
  • View 3jrc
Molmil generated image of 3jrc
CRYSTAL STRUCTURE OF FIS BOUND TO 27 BP DNA F29 CONTAINING 5 G/CS AT CENTER
Descriptor:DNA-binding protein fis, DNA (27-MER)
Authors:Stella, S., Cascio, D., Johnson, R.C.
Deposit date:2009-09-08
Release date:2010-04-28
Last modified:2017-11-01
Method:X-RAY DIFFRACTION (3.08 Å)
Cite:The shape of the DNA minor groove directs binding by the DNA-bending protein Fis.
Genes Dev., 24, 2010
3JRD
  • Download 3jrd
  • View 3jrd
Molmil generated image of 3jrd
CRYSTAL STRUCTURE OF FIS BOUND TO 27 BP DNA F25 CONTAINING T2A3 SEQUENCE AT CENTER
Descriptor:DNA-binding protein fis, DNA (27-MER)
Authors:Stella, S., Cascio, D., Johnson, R.C.
Deposit date:2009-09-08
Release date:2010-04-28
Last modified:2017-11-01
Method:X-RAY DIFFRACTION (3.1 Å)
Cite:The shape of the DNA minor groove directs binding by the DNA-bending protein Fis.
Genes Dev., 24, 2010
3JRE
  • Download 3jre
  • View 3jre
Molmil generated image of 3jre
CRYSTAL STRUCTURE OF FIS BOUND TO 27 BP DNA F26 CONTAINING A-TRACT AT CENTER
Descriptor:DNA-binding protein fis, DNA (27-MER)
Authors:Stella, S., Cascio, D., Johnson, R.C.
Deposit date:2009-09-08
Release date:2010-04-28
Last modified:2017-11-01
Method:X-RAY DIFFRACTION (3.17 Å)
Cite:The shape of the DNA minor groove directs binding by the DNA-bending protein Fis.
Genes Dev., 24, 2010
3JRF
  • Download 3jrf
  • View 3jrf
Molmil generated image of 3jrf
CRYSTAL STRUCTURE OF FIS BOUND TO 27 BP DNA F27 CONTAINING A C/G AT CENTER
Descriptor:DNA-binding protein fis, DNA (27-MER)
Authors:Stella, S., Cascio, D., Johnson, R.C.
Deposit date:2009-09-08
Release date:2010-04-28
Last modified:2017-11-01
Method:X-RAY DIFFRACTION (3.05 Å)
Cite:The shape of the DNA minor groove directs binding by the DNA-bending protein Fis.
Genes Dev., 24, 2010
3JRG
  • Download 3jrg
  • View 3jrg
Molmil generated image of 3jrg
CRYSTAL STRUCTURE OF FIS BOUND TO 27 BP NON CONSENSUS SEQUENCE DNA F18
Descriptor:DNA-binding protein fis, DNA (27-MER)
Authors:Stella, S., Cascio, D., Johnson, R.C.
Deposit date:2009-09-08
Release date:2010-04-28
Last modified:2017-11-01
Method:X-RAY DIFFRACTION (3.11 Å)
Cite:The shape of the DNA minor groove directs binding by the DNA-bending protein Fis.
Genes Dev., 24, 2010
3JRH
  • Download 3jrh
  • View 3jrh
Molmil generated image of 3jrh
CRYSTAL STRUCTURE OF FIS BOUND TO 27 BP NON CONSENSUS SEQUENCE DNA F21
Descriptor:DNA-binding protein fis, DNA (27-MER)
Authors:Stella, S., Cascio, D., Johnson, R.C.
Deposit date:2009-09-08
Release date:2010-04-28
Last modified:2017-11-01
Method:X-RAY DIFFRACTION (2.88 Å)
Cite:The shape of the DNA minor groove directs binding by the DNA-bending protein Fis.
Genes Dev., 24, 2010
3JRI
  • Download 3jri
  • View 3jri
Molmil generated image of 3jri
CRYSTAL STRUCTURE OF FIS BOUND TO 27 BP NON CONSENSUS SEQUENCE DNA F23
Descriptor:DNA-binding protein fis, DNA (27-MER)
Authors:Stella, S., Cascio, D., Johnson, R.C.
Deposit date:2009-09-08
Release date:2010-04-28
Last modified:2017-11-01
Method:X-RAY DIFFRACTION (3.11 Å)
Cite:The shape of the DNA minor groove directs binding by the DNA-bending protein Fis.
Genes Dev., 24, 2010
4CJ9
  • Download 4cj9
  • View 4cj9
Molmil generated image of 4cj9
BURRH DNA-BINDING PROTEIN FROM BURKHOLDERIA RHIZOXINICA IN ITS APO FORM
Descriptor:BURRH, SELENIUM ATOM
Authors:Stella, S., Molina, R., Lopez-Mendez, B., Campos-Olivas, R., Duchateau, P., Montoya, G.
Deposit date:2013-12-19
Release date:2014-07-09
Last modified:2014-07-23
Method:X-RAY DIFFRACTION (2.214 Å)
Cite:Bud, a Helix-Loop-Helix DNA-Binding Domain for Genome Modification
Acta Crystallogr.,Sect.D, 70, 2014
4CJA
  • Download 4cja
  • View 4cja
Molmil generated image of 4cja
BURRH DNA-BINDING PROTEIN FROM BURKHOLDERIA RHIZOXINICA IN COMPLEX WITH ITS TARGET DNA
Descriptor:BURRH, 5'-D(*DTP*TP*AP*AP*GP*AP*GP*AP*AP*GP*CP*AP*AP*DP *TP*AP*CP*GP*TP*TP*AP*TP*AP)-3', 5'-D(*DTP*AP*TP*AP*AP*CP*GP*TP*AP*TP*TP*TP*GP*CP *TP*TP*CP*TP*CP*TP*TP*AP*AP)-3'
Authors:Stella, S., Molina, R., Lopez-Mendez, B., Campos-Olivas, R., Duchateau, P., Montoya, G.
Deposit date:2013-12-19
Release date:2014-07-09
Last modified:2014-07-23
Method:X-RAY DIFFRACTION (2.651 Å)
Cite:Bud, a Helix-Loop-Helix DNA-Binding Domain for Genome Modification
Acta Crystallogr.,Sect.D, 70, 2014
5E3M
  • Download 5e3m
  • View 5e3m
Molmil generated image of 5e3m
CRYSTAL STRUCTURE OF FIS BOUND TO 27BP DNA F35 (AAATTAGTTTGAATCTCGAGCTAATTT)
Descriptor:DNA-binding protein Fis, DNA (27-MER)
Authors:Stella, S., Hancock, S.P., Cascio, D., Johnson, R.C.
Deposit date:2015-10-03
Release date:2016-03-09
Last modified:2016-03-23
Method:X-RAY DIFFRACTION (2.886 Å)
Cite:DNA Sequence Determinants Controlling Affinity, Stability and Shape of DNA Complexes Bound by the Nucleoid Protein Fis.
Plos One, 11, 2016
5MGA
  • Download 5mga
  • View 5mga
Molmil generated image of 5mga
STRUCTURE OF THE CPF1 ENDONUCLEASE R-LOOP COMPLEX AFTER DNA CLEAVAGE
Descriptor:CRISPR-associated endonuclease Cpf1, RNA (40-MER), DNA (26-MER), ...
Authors:Montoya, G., Stella, S.
Deposit date:2016-11-21
Release date:2017-06-21
Last modified:2018-10-24
Method:X-RAY DIFFRACTION (3 Å)
Cite:Structure of the Cpf1 endonuclease R-loop complex after target DNA cleavage.
Nature, 546, 2017
6GTE
  • Download 6gte
  • View 6gte
Molmil generated image of 6gte
TRANSIENT STATE STRUCTURE OF CRISPR-CPF1 (CAS12A) I3 CONFORMATION
Descriptor:CRISPR-associated endonuclease Cas12a, RNA (29-MER), DNA (5'-D(P*AP*TP*GP*AP*CP*TP*TP*CP*TP*CP*TP*AP*AP*CP*AP*AP*GP*CP*TP*CP*G)-3'), ...
Authors:Montoya, G., Mesa, P., Stella, S.
Deposit date:2018-06-18
Release date:2018-12-19
Last modified:2018-12-26
Method:ELECTRON MICROSCOPY (4.07 Å)
Cite:Conformational Activation Promotes CRISPR-Cas12a Catalysis and Resetting of the Endonuclease Activity.
Cell, 175, 2018
6GTF
  • Download 6gtf
  • View 6gtf
Molmil generated image of 6gtf
TRANSIENT STATE STRUCTURE OF CRISPR-CPF1 (CAS12A) I5 CONFORMATION
Descriptor:CRISPR-associated endonuclease Cas12a, RNA (29-MER), DNA (5'-D(P*AP*TP*GP*AP*CP*TP*TP*CP*TP*CP*TP*AP*AP*CP*AP*AP*GP*CP*TP*CP*G)-3'), ...
Authors:Montoya, G., Mesa, P., Stella, S.
Deposit date:2018-06-18
Release date:2018-12-19
Last modified:2018-12-26
Method:ELECTRON MICROSCOPY (3.63 Å)
Cite:Conformational Activation Promotes CRISPR-Cas12a Catalysis and Resetting of the Endonuclease Activity.
Cell, 175, 2018
6GTG
  • Download 6gtg
  • View 6gtg
Molmil generated image of 6gtg
TRANSITION STATE STRUCTURE OF CPF1(CAS12A) I4 CONFORMATION
Descriptor:CRISPR-associated endonuclease Cas12a, RNA (40-MER), DNA (32-MER), ...
Authors:Mesa, P., Montoya, G., Stella, S.
Deposit date:2018-06-18
Release date:2018-12-19
Last modified:2018-12-26
Method:ELECTRON MICROSCOPY (3.27 Å)
Cite:Conformational Activation Promotes CRISPR-Cas12a Catalysis and Resetting of the Endonuclease Activity.
Cell, 175, 2018
4AAB
  • Download 4aab
  • View 4aab
Molmil generated image of 4aab
CRYSTAL STRUCTURE OF THE MUTANT D75N I-CREI IN COMPLEX WITH ITS WILD- TYPE TARGET (THE FOUR CENTRAL BASES, 2NN REGION, ARE COMPOSED BY GTAC FROM 5' TO 3')
Descriptor:DNA ENDONUCLEASE I-CREI, 14MER DNA 5'-D(*TP*CP*AP*AP*AP*AP*CP*GP*TP*CP*GP*TP*AP*CP)-3', 10MER DNA 5'-D(*GP*AP*CP*GP*TP*TP*TP*TP*GP*AP)-3', ...
Authors:Molina, R., Redondo, P., Stella, S., Marenchino, M., D'Abramo, M., Gervasio, F.L., Epinat, J.C., Valton, J., Grizot, S., Duchateau, P., Prieto, J., Montoya, G.
Deposit date:2011-12-01
Release date:2012-05-02
Last modified:2012-08-22
Method:X-RAY DIFFRACTION (2.5 Å)
Cite:Non-Specific Protein-DNA Interactions Control I-Crei Target Binding and Cleavage.
Nucleic Acids Res., 40, 2012
4AAD
  • Download 4aad
  • View 4aad
Molmil generated image of 4aad
CRYSTAL STRUCTURE OF THE MUTANT D75N I-CREI IN COMPLEX WITH ITS WILD- TYPE TARGET IN ABSENCE OF METAL IONS AT THE ACTIVE SITE (THE FOUR CENTRAL BASES, 2NN REGION, ARE COMPOSED BY GTAC FROM 5' TO 3')
Descriptor:DNA ENDONUCLEASE I-CREI, 24MER DNA, GLYCEROL
Authors:Molina, R., Redondo, P., Stella, S., Marenchino, M., D'Abramo, M., Gervasio, F.L., Epinat, J.C., Valton, J., Grizot, S., Duchateau, P., Prieto, J., Montoya, G.
Deposit date:2011-12-01
Release date:2012-05-02
Last modified:2012-08-22
Method:X-RAY DIFFRACTION (3.1 Å)
Cite:Non-Specific Protein-DNA Interactions Control I-Crei Target Binding and Cleavage.
Nucleic Acids Res., 40, 2012
4AAE
  • Download 4aae
  • View 4aae
Molmil generated image of 4aae
CRYSTAL STRUCTURE OF THE MUTANT D75N I-CREI IN COMPLEX WITH AN ALTERED TARGET (THE FOUR CENTRAL BASES, 2NN REGION, ARE COMPOSED BY AGCG FROM 5' TO 3')
Descriptor:DNA ENDONUCLEASE I-CREI, 24MER DNA
Authors:Molina, R., Redondo, P., Stella, S., Marenchino, M., D'Abramo, M., Gervasio, F.L., Epinat, J.C., Valton, J., Grizot, S., Duchateau, P., Prieto, J., Montoya, G.
Deposit date:2011-12-01
Release date:2012-05-02
Last modified:2012-08-22
Method:X-RAY DIFFRACTION (2.6 Å)
Cite:Non-Specific Protein-DNA Interactions Control I-Crei Target Binding and Cleavage.
Nucleic Acids Res., 40, 2012
4AAF
  • Download 4aaf
  • View 4aaf
Molmil generated image of 4aaf
CRYSTAL STRUCTURE OF THE MUTANT D75N I-CREI IN COMPLEX WITH AN ALTERED TARGET (THE FOUR CENTRAL BASES, 2NN REGION, ARE COMPOSED BY TGCA FROM 5' TO 3')
Descriptor:DNA ENDONUCLEASE I-CREI, 24MER DNA, 1,2-ETHANEDIOL
Authors:Molina, R., Redondo, P., Stella, S., Marenchino, M., D'Abramo, M., Gervasio, F.L., Epinat, J.C., Valton, J., Grizot, S., Duchateau, P., Prieto, J., Montoya, G.
Deposit date:2011-12-01
Release date:2012-05-02
Last modified:2012-08-22
Method:X-RAY DIFFRACTION (2.5 Å)
Cite:Non-Specific Protein-DNA Interactions Control I-Crei Target Binding and Cleavage.
Nucleic Acids Res., 40, 2012
4AAG
  • Download 4aag
  • View 4aag
Molmil generated image of 4aag
CRYSTAL STRUCTURE OF THE MUTANT D75N I-CREI IN COMPLEX WITH ITS WILD- TYPE TARGET IN PRESENCE OF CA AT THE ACTIVE SITE (THE FOUR CENTRAL BASES, 2NN REGION, ARE COMPOSED BY GTAC FROM 5' TO 3')
Descriptor:DNA ENDONUCLEASE I-CREI, 5'-D(*TP*CP*AP*AP*AP*AP*CP*GP*TP*CP*GP*TP*AP*CP *GP*AP*CP*GP*TP*TP*TP*TP*GP*A)-3', CALCIUM ION
Authors:Molina, R., Redondo, P., Stella, S., Marenchino, M., D'Abramo, M., Gervasio, F., Epinat, J.C., Valton, J., Grizot, S., Duchateau, P., Prieto, J., Montoya, G.
Deposit date:2011-12-01
Release date:2012-05-02
Last modified:2012-08-22
Method:X-RAY DIFFRACTION (2.8 Å)
Cite:Non-Specific Protein-DNA Interactions Control I-Crei Target Binding and Cleavage.
Nucleic Acids Res., 40, 2012
4D6N
  • Download 4d6n
  • View 4d6n
Molmil generated image of 4d6n
THE CRYSTAL STRUCTURE OF I-DMOI IN COMPLEX WITH ITS TARGET DNA AT 10 DAYS INCUBATION IN 5MM MG (STATE 7)
Descriptor:HOMING ENDONUCLEASE I-DMOI, 5'-D(*DGP*CP*CP*TP*TP*GP*CP*CP*GP*GP*GP*TP*AP*DAP)-3', 5'-D(*DGP*TP*TP*CP*CP*GP*GP*CP*GP*CP*GP)-3', ...
Authors:Molina, R., Stella, S., Redondo, P., Gomez, H., Marcaida, M.J., Orozco, M., Prieto, J., Montoya, G.
Deposit date:2014-11-13
Release date:2014-12-17
Last modified:2017-08-23
Method:X-RAY DIFFRACTION (2.35 Å)
Cite:Visualizing Phosphodiester-Bond Hydrolysis by an Endonuclease.
Nat.Struct.Mol.Biol., 22, 2015
<12>