Author results

6AC7
  • Download 6ac7
  • View 6ac7
Molmil generated image of 6ac7
STRUCTURE OF A G-QUADRUPLEX
Descriptor:5'-D(*TP*GP*GP*GP*GP*TP*CP*CP*GP*AP*GP*GP*CP*GP*GP*GP*GP*CP*TP*TP*GP*GP*G)-3'
Authors:Sengar, A., Vandana, J.J., Chambers, V.S., Di Antonio, M., Winnerdy, F.R., Balasubramanian, S., Phan, A.T.
Deposit date:2018-07-25
Release date:2019-02-27
Method:SOLUTION NMR
Cite:Structure of a (3+1) hybrid G-quadruplex in the PARP1 promoter.
Nucleic Acids Res., 2018
6H1K
  • Download 6h1k
  • View 6h1k
Molmil generated image of 6h1k
THE MAJOR G-QUADRUPLEX FORM OF HIV-1 LTR
Descriptor:DNA (28-MER)
Authors:Phan, A.T., Heddi, B., Butovskaya, E., Bakalar, B., Richter, S.N.
Deposit date:2018-07-11
Release date:2018-10-17
Last modified:2018-11-07
Method:SOLUTION NMR
Cite:Major G-Quadruplex Form of HIV-1 LTR Reveals a (3 + 1) Folding Topology Containing a Stem-Loop.
J. Am. Chem. Soc., 140, 2018
6FQ2
  • Download 6fq2
  • View 6fq2
Molmil generated image of 6fq2
STRUCTURE OF MINIMAL SEQUENCE FOR LEFT -HANDED G-QUADRUPLEX FORMATION
Descriptor:DNA (5'-D(*GP*TP*GP*GP*TP*GP*GP*TP*GP*GP*TP*G)-3'), POTASSIUM ION
Authors:Schmitt, E., Mechulam, Y., Phan, A.T., Heddi, B., Bakalar, B.
Deposit date:2018-02-13
Release date:2018-12-05
Last modified:2019-02-20
Method:X-RAY DIFFRACTION (2.31 Å)
Cite:A Minimal Sequence for Left-Handed G-Quadruplex Formation.
Angew. Chem. Int. Ed. Engl., 58, 2019
2N60
  • Download 2n60
  • View 2n60
Molmil generated image of 2n60
G-QUADRUPLEXES WITH (4N-1) GUANINES IN THE G-TETRAD CORE: FORMATION OF A G-TRIAD WATER COMPLEX AND IMPLICATION FOR SMALL-MOLECULE BINDING
Descriptor:DNA (5'-D(*TP*TP*GP*TP*GP*TP*GP*GP*GP*TP*GP*GP*GP*TP*GP*GP*GP*T)-3')
Authors:Heddi, B., Martin-Pintado, N., Serimbetov, Z., Kari, T.M., Phan, A.T.
Deposit date:2015-08-08
Release date:2016-06-01
Method:SOLUTION NMR
Cite:G-quadruplexes with (4n - 1) guanines in the G-tetrad core: formation of a G-triadwater complex and implication for small-molecule binding
Nucleic Acids Res., 44, 2016
2N4Y
  • Download 2n4y
  • View 2n4y
Molmil generated image of 2n4y
STRUCTURE AND POSSIBLE FUNCTION OF A G-QUADRUPLEX IN THE LONG TERMINAL REPEAT OF THE PROVIRAL HIV-1 GENOME
Descriptor:DNA_(5'-D(*CP*TP*GP*GP*GP*CP*GP*GP*GP*AP*CP*TP*GP*GP*GP*GP*AP*GP*TP*GP*GP*T)-3')
Authors:DeNicola, B., Lech, C.J., Heddi, B., Regmi, S., Frasson, I., Perrone, R., Richter, S.N., Phan, A.T.
Deposit date:2015-07-02
Release date:2016-06-29
Last modified:2017-06-07
Method:SOLUTION NMR
Cite:Structure and possible function of a G-quadruplex in the long terminal repeat of the proviral HIV-1 genome.
Nucleic Acids Res., 44, 2016
2N3M
  • Download 2n3m
  • View 2n3m
Molmil generated image of 2n3m
G-QUADRUPLEX STRUCTURE OF AN ANTI-PROLIFERATIVE DNA SEQUENCE
Descriptor:DNA_(28-MER)
Authors:Do, N.Q., Chung, W.J., Truong, T.H.A., Heddi, B., Phan, A.T.
Deposit date:2015-06-05
Release date:2016-07-06
Last modified:2017-04-19
Method:SOLUTION NMR
Cite:G-quadruplex structure of an anti-proliferative DNA sequence
To be Published
2N21
  • Download 2n21
  • View 2n21
Molmil generated image of 2n21
SOLUTION STRUCTURE OF COMPLEX BETWEEN DNA G-QUADRUPLEX AND G-QUADRUPLEX RECOGNITION DOMAIN OF RHAU
Descriptor:ATP-dependent RNA helicase DHX36, DNA (5'-D(*TP*TP*GP*GP*GP*TP*GP*GP*GP*TP*GP*GP*GP*TP*GP*GP*GP*T)-3')
Authors:Heddi, B., Cheong, V.V., Martadinata, H., Phan, A.T.
Deposit date:2015-04-25
Release date:2015-07-29
Last modified:2018-02-07
Method:SOLUTION NMR
Cite:Insights into G-quadruplex specific recognition by the DEAH-box helicase RHAU: Solution structure of a peptide-quadruplex complex.
Proc.Natl.Acad.Sci.USA, 2015
2N16
  • Download 2n16
  • View 2n16
Molmil generated image of 2n16
SOLUTION STRUCTURE OF G-QUADRUPLEX RECOGNITION DOMAIN OF RHAU
Descriptor:ATP-dependent RNA helicase DHX36
Authors:Heddi, B., Cheong, V.V., Martadinata, H., Phan, A.T.
Deposit date:2015-03-23
Release date:2015-07-29
Last modified:2015-08-05
Method:SOLUTION NMR
Cite:Insights into G-quadruplex specific recognition by the DEAH-box helicase RHAU: Solution structure of a peptide-quadruplex complex.
Proc.Natl.Acad.Sci.USA, 2015
2MWZ
  • Download 2mwz
  • View 2mwz
Molmil generated image of 2mwz
XANTHINE AND 8-OXOGUANINE IN G-QUADRUPLEXES: FORMATION OF A G G X O TETRAD
Descriptor:DNA (5'-D(*TP*TP*GP*GP*GP*TP*TP*AP*(8OG)P*GP*GP*TP*TP*AP*GP*GP*(3ZO)P*TP*TP*AP*GP*GP*GP*A)-3')
Authors:Cheong, V.V., Heddi, B., Lech, C.J., Phan, A.T.
Deposit date:2014-12-04
Release date:2015-10-14
Last modified:2016-07-06
Method:SOLUTION NMR
Cite:Xanthine and 8-oxoguanine in G-quadruplexes: formation of a GGXO tetrad.
Nucleic Acids Res., 43, 2015
2MS9
  • Download 2ms9
  • View 2ms9
Molmil generated image of 2ms9
SOLUTION STRUCTURE OF A G-QUADRUPLEX
Descriptor:DNA (28-MER)
Authors:Chung, W.J., Heddi, B., Schmitt, E., Lim, K.W., Mechulam, Y., Phan, A.T.
Deposit date:2014-07-25
Release date:2015-02-18
Method:SOLUTION NMR
Cite:Structure of a left-handed DNA G-quadruplex
Proc.Natl.Acad.Sci.USA, 2015
4U5M
  • Download 4u5m
  • View 4u5m
Molmil generated image of 4u5m
STRUCTURE OF A LEFT-HANDED DNA G-QUADRUPLEX
Descriptor:DNA (28-MER), POTASSIUM ION, MAGNESIUM ION
Authors:Schmitt, E., Mechulam, Y., Phan, A.T., Brahim, H., Chung, W.J., Lim, K.W.
Deposit date:2014-07-25
Release date:2015-02-25
Last modified:2015-03-11
Method:X-RAY DIFFRACTION (1.5 Å)
Cite:Structure of a left-handed DNA G-quadruplex.
Proc.Natl.Acad.Sci.USA, 112, 2015
2MGN
  • Download 2mgn
  • View 2mgn
Molmil generated image of 2mgn
SOLUTION STRUCTURE OF A G-QUADRUPLEX BOUND TO THE BISQUINOLINIUM COMPOUND PHEN-DC3
Descriptor:5'-D(*TP*GP*AP*GP*GP*GP*TP*GP*GP*TP*GP*AP*GP*GP*GP*TP*GP*GP*GP*GP*AP*AP*GP*G)-3', N2,N9-bis(1-methylquinolin-3-yl)-1,10-phenanthroline-2,9-dicarboxamide
Authors:Chung, W.J., Heddi, B., Hamon, F., Teulade-Fichou, M.P., Phan, A.T.
Deposit date:2013-11-01
Release date:2014-01-22
Last modified:2014-04-02
Method:SOLUTION NMR
Cite:Solution Structure of a G-quadruplex Bound to the Bisquinolinium Compound Phen-DC3.
Angew.Chem.Int.Ed.Engl., 53, 2014
2MBJ
  • Download 2mbj
  • View 2mbj
Molmil generated image of 2mbj
STRUCTURE OF AN ANTIPARALLEL (2+2) G-QUADRUPLEX FORMED BY HUMAN TELOMERIC REPEATS IN NA+ SOLUTION (WITH G22-TO-BRG SUBSTITUTION)
Descriptor:DNA_(27-MER)
Authors:Lim, K.W., Ng, V.C.M., Martin-Pintado, N., Heddi, B., Phan, A.T.
Deposit date:2013-08-02
Release date:2013-09-18
Last modified:2014-01-08
Method:SOLUTION NMR
Cite:Structure of the human telomere in Na+ solution: an antiparallel (2+2) G-quadruplex scaffold reveals additional diversity.
Nucleic Acids Res., 41, 2013
2MB4
  • Download 2mb4
  • View 2mb4
Molmil generated image of 2mb4
SOLUTION STRUCTURE OF A STACKED DIMERIC G-QUADRUPLEX FORMED BY A SEGMENT OF THE HUMAN CEB1 MINISATELLITE
Descriptor:DNA_(5'-D(*AP*GP*GP*GP*GP*GP*GP*AP*GP*GP*GP*AP*GP*GP*GP*TP*GP*G)-3')
Authors:Adrian, M., Ang, D.J., Lech, C., Heddi, B., Nicolas, A., Phan, A.T.
Deposit date:2013-07-25
Release date:2014-05-28
Method:SOLUTION NMR
Cite:Structure and Conformational Dynamics of a Stacked Dimeric G-Quadruplex Formed by the Human CEB1 Minisatellite.
J.Am.Chem.Soc., 136, 2014
2MB2
  • Download 2mb2
  • View 2mb2
Molmil generated image of 2mb2
PARALLEL-STRANDED G-QUADRUPLEX IN DNA POLY-G STRETCHES
Descriptor:DNA_(5'-D(*TP*TP*GP*GP*GP*GP*GP*GP*GP*GP*GP*GP*GP*GP*GP*GP*GP*T)-3')
Authors:Sengar, A., Heddi, B., Phan, A.T.
Deposit date:2013-07-24
Release date:2014-12-03
Last modified:2015-01-07
Method:SOLUTION NMR
Cite:Formation of g-quadruplexes in poly-g sequences: structure of a propeller-type parallel-stranded g-quadruplex formed by a g15 stretch.
Biochemistry, 53, 2014
2MB3
  • Download 2mb3
  • View 2mb3
Molmil generated image of 2mb3
SOLUTION STRUCTURE OF AN INTRAMOLECULAR (3+1) HUMAN TELOMERIC G-QUADRUPLEX BOUND TO A TELOMESTATIN DERIVATIVE
Descriptor:DNA_(5'-D(*TP*TP*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*A)-3'), (12S,27S)-12,27-bis(4-aminobutyl)-4,30-dimethyl-3,7,14,18,22,29-hexaoxa-11,26,31,32,33,34,35,36-octaazaheptacyclo[26.2.1.1~2,5~.1~6,9~.1~13,16~.1~17,20~.1~21,24~]hexatriaconta-1(30),2(36),4,6(35),8,13(34),15,17(33),19,21(32),23,28(31)-dodecaene-10,25-dione
Authors:Chung, W.J., Heddi, B., Tera, M., Iida, K., Nagasawa, K., Phan, A.T.
Deposit date:2013-07-24
Release date:2013-08-28
Last modified:2013-09-25
Method:SOLUTION NMR
Cite:Solution structure of an intramolecular (3 + 1) human telomeric g-quadruplex bound to a telomestatin derivative.
J.Am.Chem.Soc., 135, 2013
2MAY
  • Download 2may
  • View 2may
Molmil generated image of 2may
STRUCTURE OF A G-QUADRUPLEX CONTAINING A SINGLE LNA MODIFICATION
Descriptor:DNA_(5'-D(*TP*TP*GP*LGP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*A)-3')
Authors:Lech, C., Heddi, B., Adrian, M., Li, Z., Phan, A.T.
Deposit date:2013-07-22
Release date:2015-02-04
Method:SOLUTION NMR
Cite:Engineering G4: Towards effective incorporation of locked nucleic acid into G-quadruplexes
To be Published
2M8Y
  • Download 2m8y
  • View 2m8y
Molmil generated image of 2m8y
STRUCTURE OF D[CGCGAAGCATTCGCG] HAIRPIN
Descriptor:DNA (5'-D(*CP*GP*CP*GP*AP*AP*GP*CP*AP*TP*TP*CP*GP*CP*G)-3')
Authors:Lim, K.W., Phan, A.T.
Deposit date:2013-05-30
Release date:2013-07-10
Method:SOLUTION NMR
Cite:Structural Basis of DNA Quadruplex-Duplex Junction Formation
Angew.Chem.Int.Ed.Engl., 2013
2M8Z
  • Download 2m8z
  • View 2m8z
Molmil generated image of 2m8z
STRUCTURE OF D[GGTTGGCGCGAAGCATTCGCGGGTTGG] QUADRUPLEX-DUPLEX HYBRID
Descriptor:27-MER DNA
Authors:Lim, K.W., Phan, A.T.
Deposit date:2013-05-30
Release date:2013-07-10
Method:SOLUTION NMR
Cite:Structural Basis of DNA Quadruplex-Duplex Junction Formation
Angew.Chem.Int.Ed.Engl., 2013
2M90
  • Download 2m90
  • View 2m90
Molmil generated image of 2m90
STRUCTURE OF D[GCGCGAAGCATTCGCGGGGAGGTGGGGAAGGG] QUADRUPLEX-DUPLEX HYBRID
Descriptor:32-MER DNA
Authors:Lim, K.W., Phan, A.T.
Deposit date:2013-05-30
Release date:2013-07-10
Method:SOLUTION NMR
Cite:Structural Basis of DNA Quadruplex-Duplex Junction Formation
Angew.Chem.Int.Ed.Engl., 2013
2M91
  • Download 2m91
  • View 2m91
Molmil generated image of 2m91
STRUCTURE OF D[GGGAAGGGCGCGAAGCATTCGCGAGGTAGG] QUADRUPLEX-DUPLEX HYBRID
Descriptor:30-MER DNA
Authors:Lim, K.W., Phan, A.T.
Deposit date:2013-05-30
Release date:2013-07-10
Method:SOLUTION NMR
Cite:Structural Basis of DNA Quadruplex-Duplex Junction Formation
Angew.Chem.Int.Ed.Engl., 2013
2M92
  • Download 2m92
  • View 2m92
Molmil generated image of 2m92
STRUCTURE OF D[AGGGTGGGTGCTGGGGCGCGAAGCATTCGCGAGG] QUADRUPLEX-DUPLEX HYBRID
Descriptor:34-MER DNA
Authors:Lim, K.W., Phan, A.T.
Deposit date:2013-05-30
Release date:2013-07-10
Method:SOLUTION NMR
Cite:Structural Basis of DNA Quadruplex-Duplex Junction Formation
Angew.Chem.Int.Ed.Engl., 2013
2M93
  • Download 2m93
  • View 2m93
Molmil generated image of 2m93
STRUCTURE OF D[TTGGGTGGGCGCGAAGCATTCGCGGGGTGGGT] QUADRUPLEX-DUPLEX HYBRID
Descriptor:32-MER DNA
Authors:Lim, K.W., Phan, A.T.
Deposit date:2013-05-30
Release date:2013-07-10
Method:SOLUTION NMR
Cite:Structural Basis of DNA Quadruplex-Duplex Junction Formation
Angew.Chem.Int.Ed.Engl., 2013
2M4P
  • Download 2m4p
  • View 2m4p
Molmil generated image of 2m4p
SOLUTION STRUCTURE OF AN INTRAMOLECULAR PROPELLER-TYPE G-QUADRUPLEX CONTAINING A SINGLE BULGE
Descriptor:DNA (5'-D(*TP*TP*GP*TP*GP*GP*TP*GP*GP*GP*TP*GP*GP*GP*TP*GP*GP*GP*T)-3')
Authors:Mukundan, V.T., Phan, A.T.
Deposit date:2013-02-08
Release date:2013-06-19
Method:SOLUTION NMR
Cite:Bulges in G-Quadruplexes: Broadening the Definition of G-Quadruplex-Forming Sequences.
J.Am.Chem.Soc., 135, 2013
2M18
  • Download 2m18
  • View 2m18
Molmil generated image of 2m18
STRUCTURE OF STACKED G-QUADRUPLEX FORMED BY HUMAN TERRA SEQUENCE IN POTASSIUM SOLUTION
Descriptor:RNA (5'-R(*GP*GP*GP*UP*UP*AP*GP*GP*GP*U)-3')
Authors:Martadinata, H., Phan, A.T.
Deposit date:2012-11-20
Release date:2013-04-17
Method:SOLUTION NMR
Cite:Structure of Human Telomeric RNA (TERRA): Stacking of Two G-Quadruplex Blocks in K(+) Solution
Biochemistry, 52, 2013
<123>