Author results

1FFZ
  • Download 1ffz
  • View 1ffz
Molmil generated image of 1ffz
LARGE RIBOSOMAL SUBUNIT COMPLEXED WITH R(CC)-DA-PUROMYCIN
Descriptor:23S RIBOSOMAL RNA, R(P*CP*C*)-D(P*A)-R(P*(PU))
Authors:Nissen, P., Hansen, J., Ban, N., Moore, P.B., Steitz, T.A.
Deposit date:2000-07-26
Release date:2000-08-28
Last modified:2011-07-13
Method:X-RAY DIFFRACTION (3.2 Å)
Cite:The structural basis of ribosome activity in peptide bond synthesis.
Science, 289, 2000
1FG0
  • Download 1fg0
  • View 1fg0
Molmil generated image of 1fg0
LARGE RIBOSOMAL SUBUNIT COMPLEXED WITH A 13 BP MINIHELIX-PUROMYCIN COMPOUND
Descriptor:23S RIBOSOMAL RNA, 5'-R(CCGGCGGGCUGGUUCAAACCGGCCCGCCGGACC)-3'-5'-R(P-PUROMYCIN)-3'
Authors:Nissen, P., Hansen, J., Ban, N., Moore, P.B., Steitz, T.A.
Deposit date:2000-07-26
Release date:2000-08-28
Last modified:2011-07-13
Method:X-RAY DIFFRACTION (3 Å)
Cite:The structural basis of ribosome activity in peptide bond synthesis.
Science, 289, 2000
1TTT
  • Download 1ttt
  • View 1ttt
Molmil generated image of 1ttt
PHE-TRNA, ELONGATION FACTOR EF-TU:GDPNP TERNARY COMPLEX
Descriptor:TRANSFER RIBONUCLEIC ACID (YEAST, PHE), OF ELONGATION FACTOR TU (EF-TU), ...
Authors:Nissen, P., Kjeldgaard, M., Thirup, S., Polekhina, G., Reshetnikova, L., Clark, B.F.C., Nyborg, J.
Deposit date:1995-11-16
Release date:1996-12-23
Last modified:2011-07-13
Method:X-RAY DIFFRACTION (2.7 Å)
Cite:Crystal structure of the ternary complex of Phe-tRNAPhe, EF-Tu, and a GTP analog.
Science, 270, 1995
1B23
  • Download 1b23
  • View 1b23
Molmil generated image of 1b23
E. COLI CYSTEINYL-TRNA AND T. AQUATICUS ELONGATION FACTOR EF-TU:GTP TERNARY COMPLEX
Descriptor:CYSTEINYL TRNA, ELONGATION FACTOR TU, MAGNESIUM ION, ...
Authors:Nissen, P., Kjeldgaard, M., Thirup, S., Nyborg, J.
Deposit date:1998-12-04
Release date:1998-12-07
Last modified:2011-11-16
Method:X-RAY DIFFRACTION (2.6 Å)
Cite:The crystal structure of Cys-tRNACys-EF-Tu-GDPNP reveals general and specific features in the ternary complex and in tRNA.
Structure Fold.Des., 7, 1999
3DWU
  • Download 3dwu
  • View 3dwu
Molmil generated image of 3dwu
TRANSITION-STATE MODEL CONFORMATION OF THE SWITCH I REGION FITTED INTO THE CRYO-EM MAP OF THE EEF2.80S.ALF4.GDP COMPLEX
Descriptor:Elongation factor Tu-B
Authors:Nissen, P., Nyborg, J., Kjeldgaard, M.
Deposit date:2008-07-23
Release date:2008-08-12
Last modified:2018-07-18
Method:ELECTRON MICROSCOPY (12.6 Å)
Cite:Visualization of the eEF2-80S ribosome transition-state complex by cryo-electron microscopy.
J.Mol.Biol., 382, 2008
1FFK
  • Download 1ffk
  • View 1ffk
Molmil generated image of 1ffk
CRYSTAL STRUCTURE OF THE LARGE RIBOSOMAL SUBUNIT FROM HALOARCULA MARISMORTUI AT 2.4 ANGSTROM RESOLUTION
Descriptor:23S RRNA, 5S RRNA, RIBOSOMAL PROTEIN L2, ...
Authors:Ban, N., Nissen, P., Hansen, J., Moore, P.B., Steitz, T.A.
Deposit date:2000-07-25
Release date:2000-08-14
Last modified:2011-07-13
Method:X-RAY DIFFRACTION (2.4 Å)
Cite:The complete atomic structure of the large ribosomal subunit at 2.4 A resolution.
Science, 289, 2000
3N8G
  • Download 3n8g
  • View 3n8g
Molmil generated image of 3n8g
STRUCTURE OF THE (SR)CA2+-ATPASE CA2-E1-CAAMPPCP FORM
Descriptor:Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 isoform SERCA 1a, CALCIUM ION, POTASSIUM ION, ...
Authors:Bublitz, M., Olesen, C., Poulsen, H., Morth, J.P., Moller, J.V., Nissen, P.
Deposit date:2010-05-28
Release date:2011-06-08
Last modified:2014-03-19
Method:X-RAY DIFFRACTION (2.585 Å)
Cite:Ion pathways in the sarcoplasmic reticulum Ca2+-ATPase.
J.Biol.Chem., 288, 2013
1K8A
  • Download 1k8a
  • View 1k8a
Molmil generated image of 1k8a
CO-CRYSTAL STRUCTURE OF CARBOMYCIN A BOUND TO THE 50S RIBOSOMAL SUBUNIT OF HALOARCULA MARISMORTUI
Descriptor:23S RRNA, 5S RRNA, RIBOSOMAL PROTEIN L2, ...
Authors:Hansen, J.L., Ippolito, J.A., Ban, N., Nissen, P., Moore, P.B., Steitz, T.
Deposit date:2001-10-23
Release date:2002-07-19
Last modified:2011-07-13
Method:X-RAY DIFFRACTION (3 Å)
Cite:The structures of four macrolide antibiotics bound to the large ribosomal subunit.
Mol.Cell, 10, 2002
1TUI
  • Download 1tui
  • View 1tui
Molmil generated image of 1tui
INTACT ELONGATION FACTOR TU IN COMPLEX WITH GDP
Descriptor:ELONGATION FACTOR TU, MAGNESIUM ION, GUANOSINE-5'-DIPHOSPHATE
Authors:Polekhina, G., Thirup, S., Kjeldgaard, M., Nissen, P., Lippmann, C., Nyborg, J.
Deposit date:1996-05-23
Release date:1997-06-05
Last modified:2011-07-13
Method:X-RAY DIFFRACTION (2.7 Å)
Cite:Helix unwinding in the effector region of elongation factor EF-Tu-GDP.
Structure, 4, 1996
1C04
  • Download 1c04
  • View 1c04
Molmil generated image of 1c04
IDENTIFICATION OF KNOWN PROTEIN AND RNA STRUCTURES IN A 5 A MAP OF THE LARGE RIBOSOMAL SUBUNIT FROM HALOARCULA MARISMORTUI
Descriptor:23S RRNA FRAGMENT, RIBOSOMAL PROTEIN L2, RIBOSOMAL PROTEIN L6, ...
Authors:Ban, N., Nissen, P., Capel, M., Moore, P.B., Steitz, T.A.
Deposit date:1999-07-14
Release date:1999-08-31
Last modified:2011-07-13
Method:X-RAY DIFFRACTION (5 Å)
Cite:Placement of protein and RNA structures into a 5 A-resolution map of the 50S ribosomal subunit.
Nature, 400, 1999
5KSD
  • Download 5ksd
  • View 5ksd
Molmil generated image of 5ksd
CRYSTAL STRUCTURE OF A PLASMA MEMBRANE PROTON PUMP
Descriptor:ATPase 2, plasma membrane-type, MAGNESIUM ION, ...
Authors:Croll, T., Pedersen, B.P., Nissen, P.
Deposit date:2016-07-08
Release date:2016-08-10
Last modified:2017-05-17
Method:X-RAY DIFFRACTION (3.5 Å)
Cite:Improved Model of Proton Pump Crystal Structure Obtained by Interactive Molecular Dynamics Flexible Fitting Expands the Mechanistic Model for Proton Translocation in P-Type ATPases.
Front Physiol, 8, 2017
4BEV
  • Download 4bev
  • View 4bev
Molmil generated image of 4bev
ATPASE CRYSTAL STRUCTURE WITH BOUND PHOSPHATE ANALOGUE
Descriptor:COPPER EFFLUX ATPASE, MAGNESIUM ION, TRIFLUOROMAGNESATE
Authors:Mattle, D., Drachmann, N.D., Liu, X.Y., Gourdon, P., Pedersen, B.P., Morth, P., Wang, J., Nissen, P.
Deposit date:2013-03-12
Release date:2014-04-02
Method:X-RAY DIFFRACTION (3.583 Å)
Cite:ATPase Crystal Structure with Bound Phosphate Analogue
To be Published
5I32
  • Download 5i32
  • View 5i32
Molmil generated image of 5i32
AMMONIA PERMEABLE AQUAPORIN ATTIP2;1
Descriptor:Aquaporin TIP2-1
Authors:Kirscht, A., Nissen, P., Kjellbom, P., Gourdon, P., Johanson, U.
Deposit date:2016-02-09
Release date:2016-04-06
Method:X-RAY DIFFRACTION (1.18 Å)
Cite:Crystal Structure of an Ammonia-Permeable Aquaporin.
Plos Biol., 14, 2016
3F6K
  • Download 3f6k
  • View 3f6k
Molmil generated image of 3f6k
CRYSTAL STRUCTURE OF THE VPS10P DOMAIN OF HUMAN SORTILIN/NTS3 IN COMPLEX WITH NEUROTENSIN
Descriptor:Sortilin, Neurotensin, N-ACETYL-D-GLUCOSAMINE, ...
Authors:Quistgaard, E.M., Madsen, P., Groftehauge, M.K., Nissen, P., Petersen, C.M., Thirup, S.
Deposit date:2008-11-06
Release date:2008-12-30
Last modified:2011-07-13
Method:X-RAY DIFFRACTION (2 Å)
Cite:Ligands bind to Sortilin in the tunnel of a ten-bladed beta-propeller domain.
Nat.Struct.Mol.Biol., 16, 2009
3RFU
  • Download 3rfu
  • View 3rfu
Molmil generated image of 3rfu
CRYSTAL STRUCTURE OF A COPPER-TRANSPORTING PIB-TYPE ATPASE
Descriptor:Copper efflux ATPase, TETRAFLUOROALUMINATE ION, MAGNESIUM ION, ...
Authors:Gourdon, P., Liu, X., Skjorringe, T., Morth, J.P., Birk Moller, L., Panyella Pedersen, B., Nissen, P.
Deposit date:2011-04-07
Release date:2011-06-29
Last modified:2011-07-13
Method:X-RAY DIFFRACTION (3.2 Å)
Cite:Crystal structure of a copper-transporting PIB-type ATPase.
Nature, 475, 2011
4BBJ
  • Download 4bbj
  • View 4bbj
Molmil generated image of 4bbj
COPPER-TRANSPORTING PIB-ATPASE IN COMPLEX WITH BERYLLIUM FLUORIDE REPRESENTING THE E2P STATE
Descriptor:COPPER EFFLUX ATPASE, MAGNESIUM ION, NICOTINAMIDE-ADENINE-DINUCLEOTIDE, ...
Authors:Mattle, D., Gourdon, P., Nissen, P.
Deposit date:2012-09-25
Release date:2013-12-11
Last modified:2015-04-15
Method:X-RAY DIFFRACTION (2.75 Å)
Cite:Copper-Transporting P-Type Atpases Use a Unique Ion-Release Pathway
Nat.Struct.Mol.Biol., 21, 2014
4BEW
  • Download 4bew
  • View 4bew
Molmil generated image of 4bew
SERCA BOUND TO PHOSPHATE ANALOGUE
Descriptor:SARCOPLASMIC/ENDOPLASMIC RETICULUM CALCIUM ATPASE 1, MAGNESIUM ION, POTASSIUM ION, ...
Authors:Drachmann, N.D., Mattle, D., Laursen, M., Bublitz, M., Olesen, C., Moeller, J.V., Nissen, P., Morth, J.P.
Deposit date:2013-03-12
Release date:2014-02-19
Last modified:2019-02-06
Method:X-RAY DIFFRACTION (2.5 Å)
Cite:Serca Bound to Phosphate Analogue
To be Published
4BYG
  • Download 4byg
  • View 4byg
Molmil generated image of 4byg
ATPASE CRYSTAL STRUCTURE
Descriptor:COPPER EFFLUX ATPASE, TETRAFLUOROALUMINATE ION, MAGNESIUM ION, ...
Authors:Mattle, D., Drachmann, N.D., Liu, X.Y., Pedersen, B.P., Morth, J.P., Wang, J., Gourdon, P., Nissen, P.
Deposit date:2013-07-19
Release date:2014-08-06
Last modified:2019-02-06
Method:X-RAY DIFFRACTION (2.85 Å)
Cite:Dephosphorylation of Pib-Type Cu(I)-Atpases as Studied by Metallofluoride Complexes
To be Published
4HQJ
  • Download 4hqj
  • View 4hqj
Molmil generated image of 4hqj
CRYSTAL STRUCTURE OF NA+,K+-ATPASE IN THE NA+-BOUND STATE
Descriptor:Sodium/potassium-transporting ATPase subunit alpha-1, Sodium/potassium-transporting ATPase subunit beta-1, Na+/K+ ATPase gamma subunit transcript variant a, ...
Authors:Nyblom, M., Reinhard, L., Gourdon, P., Nissen, P.
Deposit date:2012-10-25
Release date:2013-10-02
Last modified:2014-09-10
Method:X-RAY DIFFRACTION (4.3 Å)
Cite:Crystal structure of Na+, K(+)-ATPase in the Na(+)-bound state.
Science, 342, 2013
4J2T
  • Download 4j2t
  • View 4j2t
Molmil generated image of 4j2t
INHIBITOR-BOUND CA2+ ATPASE
Descriptor:SERCA1a, (3S,3aR,4S,6S,6aR,7S,8S,9bS)-6-(acetyloxy)-3a,4-bis(butanoyloxy)-3-hydroxy-3,6,9-trimethyl-8-{[(2E)-2-methylbut-2-enoyl]oxy}-2-oxo-2,3,3a,4,5,6,6a,7,8,9b-decahydroazuleno[4,5-b]furan-7-yl octanoate, PHOSPHATIDYLETHANOLAMINE, ...
Authors:Paulsen, E.S., Villadsen, J., Tenori, E., Liu, H., Lie, M.A., Bonde, D.F., Bublitz, M., Olesen, C., Autzen, H.E., Dach, I., Sehgal, P., Moller, J.V., Schiott, B., Nissen, P., Christensen, S.B.
Deposit date:2013-02-05
Release date:2013-06-19
Last modified:2018-01-24
Method:X-RAY DIFFRACTION (3.2 Å)
Cite:Water-mediated interactions influence the binding of thapsigargin to sarco/endoplasmic reticulum calcium adenosinetriphosphatase.
J.Med.Chem., 56, 2013
4UMV
  • Download 4umv
  • View 4umv
Molmil generated image of 4umv
CRYSTAL STRUCTURE OF A ZINC-TRANSPORTING PIB-TYPE ATPASE IN THE E2P STATE
Descriptor:ZINC-TRANSPORTING ATPASE, MAGNESIUM ION, BERYLLIUM TRIFLUORIDE ION
Authors:Wang, K.T., Sitsel, O., Meloni, G., Autzen, H.E., Andersson, M., Klymchuk, T., Nielsen, A.M., Rees, D.C., Nissen, P., Gourdon, P.
Deposit date:2014-05-21
Release date:2014-08-13
Last modified:2014-10-29
Method:X-RAY DIFFRACTION (3.2 Å)
Cite:Structure and Mechanism of Zn(2+)-Transporting P-Type Atpases.
Nature, 514, 2014
4UMW
  • Download 4umw
  • View 4umw
Molmil generated image of 4umw
CRYSTAL STRUCTURE OF A ZINC-TRANSPORTING PIB-TYPE ATPASE IN E2.PI STATE
Descriptor:ZINC-TRANSPORTING ATPASE, TETRAFLUOROALUMINATE ION, MAGNESIUM ION
Authors:Wang, K.T., Sitsel, O., Meloni, G., Autzen, H.E., Andersson, M., Klymchuk, T., Nielsen, A.M., Rees, D.C., Nissen, P., Gourdon, P.
Deposit date:2014-05-21
Release date:2014-08-13
Last modified:2014-10-29
Method:X-RAY DIFFRACTION (2.705 Å)
Cite:Structure and Mechanism of Zn(2+)-Transporting P-Type Atpases.
Nature, 514, 2014
5JAE
  • Download 5jae
  • View 5jae
Molmil generated image of 5jae
LEUT IN THE OUTWARD-ORIENTED, NA+-FREE RETURN STATE, P21 FORM AT PH 6.5
Descriptor:Transporter, B-OCTYLGLUCOSIDE
Authors:Malinauskaite, L., Sahin, C., Said, S., Grouleff, J., Shahsavar, A., Bjerregaard, H., Noer, P., Severinsen, K., Boesen, T., Schiott, B., Sinning, S., Nissen, P.
Deposit date:2016-04-12
Release date:2016-06-01
Method:X-RAY DIFFRACTION (2.5 Å)
Cite:A conserved leucine occupies the empty substrate site of LeuT in the Na(+)-free return state.
Nat Commun, 7, 2016
5JAF
  • Download 5jaf
  • View 5jaf
Molmil generated image of 5jaf
LEUT NA+-FREE RETURN STATE, C2 FORM AT PH 5
Descriptor:Transporter, B-OCTYLGLUCOSIDE
Authors:Malinauskaite, L., Sahin, C., Said, S., Grouleff, J., Shahsavar, A., Bjerregaard, H., Noer, P., Severinsen, K., Boesen, T., Schiott, B., Sinning, S., Nissen, P.
Deposit date:2016-04-12
Release date:2016-06-01
Method:X-RAY DIFFRACTION (3.021 Å)
Cite:A conserved leucine occupies the empty substrate site of LeuT in the Na(+)-free return state.
Nat Commun, 7, 2016
5JAG
  • Download 5jag
  • View 5jag
Molmil generated image of 5jag
LEUT T354H MUTANT IN THE OUTWARD-ORIENTED, NA+-FREE RETURN STATE
Descriptor:Transporter, B-OCTYLGLUCOSIDE
Authors:Malinauskaite, L., Sahin, C., Said, S., Grouleff, J., Shahsavar, A., Bjerregaard, H., Noer, P., Severinsen, K., Boesen, T., Schiott, B., Sinning, S., Nissen, P.
Deposit date:2016-04-12
Release date:2016-06-01
Method:X-RAY DIFFRACTION (2.58 Å)
Cite:A conserved leucine occupies the empty substrate site of LeuT in the Na(+)-free return state.
Nat Commun, 7, 2016