1B23
| E. coli cysteinyl-tRNA and T. aquaticus elongation factor EF-TU:GTP ternary complex | Descriptor: | CYSTEINE, CYSTEINYL TRNA, ELONGATION FACTOR TU, ... | Authors: | Nissen, P, Kjeldgaard, M, Thirup, S, Nyborg, J. | Deposit date: | 1998-12-04 | Release date: | 1998-12-07 | Last modified: | 2023-08-09 | Method: | X-RAY DIFFRACTION (2.6 Å) | Cite: | The crystal structure of Cys-tRNACys-EF-Tu-GDPNP reveals general and specific features in the ternary complex and in tRNA. Structure Fold.Des., 7, 1999
|
|
1TTT
| Phe-tRNA, elongation factoR EF-TU:GDPNP ternary complex | Descriptor: | MAGNESIUM ION, OF ELONGATION FACTOR TU (EF-TU), PHENYLALANINE, ... | Authors: | Nissen, P, Kjeldgaard, M, Thirup, S, Polekhina, G, Reshetnikova, L, Clark, B.F.C, Nyborg, J. | Deposit date: | 1995-11-16 | Release date: | 1996-12-23 | Last modified: | 2024-02-14 | Method: | X-RAY DIFFRACTION (2.7 Å) | Cite: | Crystal structure of the ternary complex of Phe-tRNAPhe, EF-Tu, and a GTP analog. Science, 270, 1995
|
|
1FG0
| LARGE RIBOSOMAL SUBUNIT COMPLEXED WITH A 13 BP MINIHELIX-PUROMYCIN COMPOUND | Descriptor: | 23S RIBOSOMAL RNA, 5'-R(CCGGCGGGCUGGUUCAAACCGGCCCGCCGGACC)-3'-5'-R(P-PUROMYCIN)-3' | Authors: | Nissen, P, Hansen, J, Ban, N, Moore, P.B, Steitz, T.A. | Deposit date: | 2000-07-26 | Release date: | 2000-08-28 | Last modified: | 2024-02-07 | Method: | X-RAY DIFFRACTION (3 Å) | Cite: | The structural basis of ribosome activity in peptide bond synthesis. Science, 289, 2000
|
|
1FFZ
| LARGE RIBOSOMAL SUBUNIT COMPLEXED WITH R(CC)-DA-PUROMYCIN | Descriptor: | 23S RIBOSOMAL RNA, R(P*CP*C*)-D(P*A)-R(P*(PU)) | Authors: | Nissen, P, Hansen, J, Ban, N, Moore, P.B, Steitz, T.A. | Deposit date: | 2000-07-26 | Release date: | 2000-08-28 | Last modified: | 2024-02-07 | Method: | X-RAY DIFFRACTION (3.2 Å) | Cite: | The structural basis of ribosome activity in peptide bond synthesis. Science, 289, 2000
|
|
7ZGO
| Cryo-EM structure of human NKCC1 (TM domain) | Descriptor: | (2S)-3-(hexadecanoyloxy)-2-[(9Z)-octadec-9-enoyloxy]propyl 2-(trimethylammonio)ethyl phosphate, CHLORIDE ION, CHOLESTEROL HEMISUCCINATE, ... | Authors: | Nissen, P, Fenton, R, Neumann, C, Lindtoft Rosenbaek, L, Kock Flygaard, R, Habeck, M, Lykkegaard Karlsen, J, Wang, Y, Lindorff-Larsen, K, Gad, H, Hartmann, R, Lyons, J. | Deposit date: | 2022-04-04 | Release date: | 2022-10-05 | Last modified: | 2023-04-19 | Method: | ELECTRON MICROSCOPY (2.55 Å) | Cite: | Cryo-EM structure of the human NKCC1 transporter reveals mechanisms of ion coupling and specificity. Embo J., 41, 2022
|
|
3DWU
| |
1C04
| IDENTIFICATION OF KNOWN PROTEIN AND RNA STRUCTURES IN A 5 A MAP OF THE LARGE RIBOSOMAL SUBUNIT FROM HALOARCULA MARISMORTUI | Descriptor: | 23S RRNA FRAGMENT, RIBOSOMAL PROTEIN L11, RIBOSOMAL PROTEIN L14, ... | Authors: | Ban, N, Nissen, P, Capel, M, Moore, P.B, Steitz, T.A. | Deposit date: | 1999-07-14 | Release date: | 1999-08-31 | Last modified: | 2011-07-13 | Method: | X-RAY DIFFRACTION (5 Å) | Cite: | Placement of protein and RNA structures into a 5 A-resolution map of the 50S ribosomal subunit. Nature, 400, 1999
|
|
7QTV
| Beryllium fluoride form of the Na+,K+-ATPase (E2-BeFx) | Descriptor: | 1-O-decanoyl-beta-D-tagatofuranosyl beta-D-allopyranoside, 2-acetamido-2-deoxy-beta-D-glucopyranose, 2-acetamido-2-deoxy-beta-D-glucopyranose-(1-4)-2-acetamido-2-deoxy-beta-D-glucopyranose, ... | Authors: | Fruergaard, M.U, Dach, I, Andersen, J.L, Ozol, M, Shahsavar, A, Quistgaard, E.M, Poulsen, H, Fedosova, N.U, Nissen, P. | Deposit date: | 2022-01-16 | Release date: | 2022-11-23 | Last modified: | 2024-01-31 | Method: | X-RAY DIFFRACTION (4.05 Å) | Cite: | The Na + ,K + -ATPase in complex with beryllium fluoride mimics an ATPase phosphorylated state. J.Biol.Chem., 298, 2022
|
|
7YZR
| 50 mM Rb+ soak of beryllium fluoride inhibited Na+,K+-ATPase, E2-BeFx (rigid body model) | Descriptor: | BERYLLIUM TRIFLUORIDE ION, FXYD domain-containing ion transport regulator, MAGNESIUM ION, ... | Authors: | Fruergaard, M.U, Dach, I, Andersen, J.L, Ozol, M, Shasavar, A, Quistgaard, E.M, Poulsen, H, Fedosova, N.U, Nissen, P. | Deposit date: | 2022-02-21 | Release date: | 2022-11-23 | Last modified: | 2024-01-31 | Method: | X-RAY DIFFRACTION (6.92 Å) | Cite: | The Na + ,K + -ATPase in complex with beryllium fluoride mimics an ATPase phosphorylated state. J.Biol.Chem., 298, 2022
|
|
7Z04
| 10 mM Rb+ soak of beryllium fluoride inhibited Na+,K+-ATPase, E2-BeFx (rigid body model) | Descriptor: | BERYLLIUM TRIFLUORIDE ION, FXYD domain-containing ion transport regulator, MAGNESIUM ION, ... | Authors: | Fruergaard, M.U, Dach, I, Andersen, J.L, Ozol, M, Shasavar, A, Quistgaard, E.M, Poulsen, H, Fedosova, N.U, Nissen, P. | Deposit date: | 2022-02-22 | Release date: | 2022-11-23 | Last modified: | 2024-01-31 | Method: | X-RAY DIFFRACTION (7.5 Å) | Cite: | The Na + ,K + -ATPase in complex with beryllium fluoride mimics an ATPase phosphorylated state. J.Biol.Chem., 298, 2022
|
|
6HXB
| SERCA2a from pig heart | Descriptor: | CALCIUM ION, PHOSPHOMETHYLPHOSPHONIC ACID ADENYLATE ESTER, POTASSIUM ION, ... | Authors: | Sitsel, A, Andersen, J.L, Nissen, P, Olesen, C. | Deposit date: | 2018-10-16 | Release date: | 2019-02-27 | Last modified: | 2020-09-30 | Method: | X-RAY DIFFRACTION (4 Å) | Cite: | Structures of the heart specific SERCA2a Ca 2+ -ATPase. Embo J., 38, 2019
|
|
5I32
| Ammonia permeable aquaporin AtTIP2;1 | Descriptor: | Aquaporin TIP2-1 | Authors: | Kirscht, A, Nissen, P, Kjellbom, P, Gourdon, P, Johanson, U. | Deposit date: | 2016-02-09 | Release date: | 2016-04-06 | Last modified: | 2024-01-10 | Method: | X-RAY DIFFRACTION (1.18 Å) | Cite: | Crystal Structure of an Ammonia-Permeable Aquaporin. Plos Biol., 14, 2016
|
|
5KSD
| Crystal Structure of a Plasma Membrane Proton Pump | Descriptor: | ATPase 2, plasma membrane-type, DODECYL-BETA-D-MALTOSIDE, ... | Authors: | Croll, T, Pedersen, B.P, Nissen, P. | Deposit date: | 2016-07-08 | Release date: | 2016-08-10 | Last modified: | 2017-05-17 | Method: | X-RAY DIFFRACTION (3.5 Å) | Cite: | Improved Model of Proton Pump Crystal Structure Obtained by Interactive Molecular Dynamics Flexible Fitting Expands the Mechanistic Model for Proton Translocation in P-Type ATPases. Front Physiol, 8, 2017
|
|
5JAE
| LeuT in the outward-oriented, Na+-free return state, P21 form at pH 6.5 | Descriptor: | Transporter, octyl beta-D-glucopyranoside | Authors: | Malinauskaite, L, Sahin, C, Said, S, Grouleff, J, Shahsavar, A, Bjerregaard, H, Noer, P, Severinsen, K, Boesen, T, Schiott, B, Sinning, S, Nissen, P. | Deposit date: | 2016-04-12 | Release date: | 2016-06-01 | Last modified: | 2024-01-10 | Method: | X-RAY DIFFRACTION (2.5 Å) | Cite: | A conserved leucine occupies the empty substrate site of LeuT in the Na(+)-free return state. Nat Commun, 7, 2016
|
|
5JAG
| LeuT T354H mutant in the outward-oriented, Na+-free Return State | Descriptor: | Transporter, octyl beta-D-glucopyranoside | Authors: | Malinauskaite, L, Sahin, C, Said, S, Grouleff, J, Shahsavar, A, Bjerregaard, H, Noer, P, Severinsen, K, Boesen, T, Schiott, B, Sinning, S, Nissen, P. | Deposit date: | 2016-04-12 | Release date: | 2016-06-01 | Last modified: | 2024-01-10 | Method: | X-RAY DIFFRACTION (2.58 Å) | Cite: | A conserved leucine occupies the empty substrate site of LeuT in the Na(+)-free return state. Nat Commun, 7, 2016
|
|
5JAF
| LeuT Na+-free Return State, C2 form at pH 5 | Descriptor: | Transporter, octyl beta-D-glucopyranoside | Authors: | Malinauskaite, L, Sahin, C, Said, S, Grouleff, J, Shahsavar, A, Bjerregaard, H, Noer, P, Severinsen, K, Boesen, T, Schiott, B, Sinning, S, Nissen, P. | Deposit date: | 2016-04-12 | Release date: | 2016-06-01 | Last modified: | 2024-01-10 | Method: | X-RAY DIFFRACTION (3.021 Å) | Cite: | A conserved leucine occupies the empty substrate site of LeuT in the Na(+)-free return state. Nat Commun, 7, 2016
|
|
1FFK
| CRYSTAL STRUCTURE OF THE LARGE RIBOSOMAL SUBUNIT FROM HALOARCULA MARISMORTUI AT 2.4 ANGSTROM RESOLUTION | Descriptor: | 23S RRNA, 5S RRNA, CADMIUM ION, ... | Authors: | Ban, N, Nissen, P, Hansen, J, Moore, P.B, Steitz, T.A. | Deposit date: | 2000-07-25 | Release date: | 2000-08-14 | Last modified: | 2024-02-07 | Method: | X-RAY DIFFRACTION (2.4 Å) | Cite: | The complete atomic structure of the large ribosomal subunit at 2.4 A resolution. Science, 289, 2000
|
|
4US7
| Sulfur SAD Phased Structure of a Type IV Pilus Protein from Shewanella oneidensis | Descriptor: | PILD PROCESSED PROTEIN, SODIUM ION, SULFATE ION | Authors: | Gorgel, M, Boeggild, A, Ulstrup, J.J, Mueller, U, Weiss, M, Nissen, P, Boesen, T. | Deposit date: | 2014-07-03 | Release date: | 2015-04-29 | Method: | X-RAY DIFFRACTION (1.96 Å) | Cite: | High-Resolution Structure of a Type Iv Pilin from the Metal- Reducing Bacterium Shewanella Oneidensis. Bmc Struct.Biol., 15, 2015
|
|
4US4
| Crystal Structure of the Bacterial NSS Member MhsT in an Occluded Inward-Facing State (lipidic cubic phase form) | Descriptor: | (2R)-2,3-DIHYDROXYPROPYL(7Z)-PENTADEC-7-ENOATE, (2S)-2,3-DIHYDROXYPROPYL(7Z)-PENTADEC-7-ENOATE, SODIUM ION, ... | Authors: | Malinauskaite, L, Quick, M, Reinhard, L, Lyons, J.A, Yano, H, Javitch, J.A, Nissen, P. | Deposit date: | 2014-07-02 | Release date: | 2014-09-24 | Last modified: | 2024-01-10 | Method: | X-RAY DIFFRACTION (2.6 Å) | Cite: | A Mechanism for Intracellular Release of Na+ by Neurotransmitter/Sodium Symporters Nat.Struct.Mol.Biol., 21, 2014
|
|
4UU0
| CRYSTAL STRUCTURE OF (SR) CALCIUM-ATPASE E2(TG) IN THE PRESENCE OF 14:1 PC | Descriptor: | GLYCEROL, MAGNESIUM ION, OCTANOIC ACID [3S-[3ALPHA, ... | Authors: | Drachmann, N.D, Olesen, C, Moeller, J.V, Guo, Z, Nissen, P, Bublitz, M. | Deposit date: | 2014-07-24 | Release date: | 2014-10-01 | Last modified: | 2024-01-10 | Method: | X-RAY DIFFRACTION (2.5 Å) | Cite: | Comparing Crystal Structures of Ca(2+) -ATPase in the Presence of Different Lipids. FEBS J., 281, 2014
|
|
4UU1
| CRYSTAL STRUCTURE OF (SR) CALCIUM-ATPASE E2(TG) IN THE PRESENCE OF DOPC | Descriptor: | 1,2-DIOLEOYL-SN-GLYCERO-3-PHOSPHOCHOLINE, GLYCEROL, MAGNESIUM ION, ... | Authors: | Drachmann, N.D, Olesen, C, Moeller, J.V, Guo, Z, Nissen, P, Bublitz, M. | Deposit date: | 2014-07-24 | Release date: | 2014-10-01 | Last modified: | 2024-01-10 | Method: | X-RAY DIFFRACTION (2.8 Å) | Cite: | Comparing Crystal Structures of Ca(2+) -ATPase in the Presence of Different Lipids. FEBS J., 281, 2014
|
|
4V69
| Ternary complex-bound E.coli 70S ribosome. | Descriptor: | 16S rRNA, 23S ribosomal RNA, 30S ribosomal protein S10, ... | Authors: | Villa, E, Sengupta, J, Trabuco, L.G, LeBarron, J, Baxter, W.T, Shaikh, T.R, Grassucci, R.A, Nissen, P, Ehrenberg, M, Schulten, K, Frank, J. | Deposit date: | 2008-12-11 | Release date: | 2014-07-09 | Last modified: | 2024-02-28 | Method: | ELECTRON MICROSCOPY (6.7 Å) | Cite: | Ribosome-induced changes in elongation factor Tu conformation control GTP hydrolysis Proc.Natl.Acad.Sci.USA, 106, 2009
|
|
5O1S
| |
5MPM
| SERCA2a from pig heart | Descriptor: | (6AR,11AS,11BR)-10-ACETYL-9-HYDROXY-7,7-DIMETHYL-2,6,6A,7,11A,11B-HEXAHYDRO-11H-PYRROLO[1',2':2,3]ISOINDOLO[4,5,6-CD]INDOL-11-ONE, MAGNESIUM ION, POTASSIUM ION, ... | Authors: | Drachmann, N.D, Sitsel, A, Andersen, J.L, Nissen, P, Olesen, C. | Deposit date: | 2016-12-16 | Release date: | 2018-01-17 | Last modified: | 2024-01-17 | Method: | X-RAY DIFFRACTION (3.3 Å) | Cite: | Structures of the heart specific SERCA2a Ca2+-ATPase. Embo J., 38, 2019
|
|
6HEF
| Room temperature structure of the (SR)Ca2+-ATPase Ca2-E1-CaAMPPCP form | Descriptor: | 1,2-DIOLEOYL-SN-GLYCERO-3-PHOSPHOCHOLINE, CALCIUM ION, PHOSPHOMETHYLPHOSPHONIC ACID ADENYLATE ESTER, ... | Authors: | Hjorth-Jensen, S, Sorensen, T.L.M, Oksanen, E, Andersen, J.L, Olesen, C, Moller, J.V, Nissen, P. | Deposit date: | 2018-08-20 | Release date: | 2018-08-29 | Last modified: | 2024-01-17 | Method: | X-RAY DIFFRACTION (3.538 Å) | Cite: | Membrane-protein crystals for neutron diffraction. Acta Crystallogr D Struct Biol, 74, 2018
|
|