Author results

1FFK
  • Download 1ffk
  • View 1ffk
Molmil generated image of 1ffk
CRYSTAL STRUCTURE OF THE LARGE RIBOSOMAL SUBUNIT FROM HALOARCULA MARISMORTUI AT 2.4 ANGSTROM RESOLUTION
Descriptor:23S RRNA, 5S RRNA, RIBOSOMAL PROTEIN L2, ...
Authors:Ban, N., Nissen, P., Hansen, J., Moore, P.B., Steitz, T.A.
Deposit date:2000-07-25
Release date:2000-08-14
Last modified:2011-07-13
Method:X-RAY DIFFRACTION (2.4 Å)
Cite:The complete atomic structure of the large ribosomal subunit at 2.4 A resolution.
Science, 289, 2000
1FFZ
  • Download 1ffz
  • View 1ffz
Molmil generated image of 1ffz
LARGE RIBOSOMAL SUBUNIT COMPLEXED WITH R(CC)-DA-PUROMYCIN
Descriptor:23S RIBOSOMAL RNA, R(P*CP*C*)-D(P*A)-R(P*(PU))
Authors:Nissen, P., Hansen, J., Ban, N., Moore, P.B., Steitz, T.A.
Deposit date:2000-07-26
Release date:2000-08-28
Last modified:2011-07-13
Method:X-RAY DIFFRACTION (3.2 Å)
Cite:The structural basis of ribosome activity in peptide bond synthesis.
Science, 289, 2000
1FG0
  • Download 1fg0
  • View 1fg0
Molmil generated image of 1fg0
LARGE RIBOSOMAL SUBUNIT COMPLEXED WITH A 13 BP MINIHELIX-PUROMYCIN COMPOUND
Descriptor:23S RIBOSOMAL RNA, 5'-R(CCGGCGGGCUGGUUCAAACCGGCCCGCCGGACC)-3'-5'-R(P-PUROMYCIN)-3'
Authors:Nissen, P., Hansen, J., Ban, N., Moore, P.B., Steitz, T.A.
Deposit date:2000-07-26
Release date:2000-08-28
Last modified:2011-07-13
Method:X-RAY DIFFRACTION (3 Å)
Cite:The structural basis of ribosome activity in peptide bond synthesis.
Science, 289, 2000
1K73
  • Download 1k73
  • View 1k73
Molmil generated image of 1k73
CO-CRYSTAL STRUCTURE OF ANISOMYCIN BOUND TO THE 50S RIBOSOMAL SUBUNIT
Descriptor:23S RRNA, 5S RRNA, RIBOSOMAL PROTEIN L2, ...
Authors:Hansen, J., Ban, N., Nissen, P., Moore, P.B., Steitz, T.A.
Deposit date:2001-10-18
Release date:2003-07-22
Last modified:2011-07-13
Method:X-RAY DIFFRACTION (3.01 Å)
Cite:Structures of Five Antibiotics Bound at the Peptidyl Transferase Center of the Large Ribosomal Subunit
J.Mol.Biol., 330, 2003
1K8A
  • Download 1k8a
  • View 1k8a
Molmil generated image of 1k8a
CO-CRYSTAL STRUCTURE OF CARBOMYCIN A BOUND TO THE 50S RIBOSOMAL SUBUNIT OF HALOARCULA MARISMORTUI
Descriptor:23S RRNA, 5S RRNA, RIBOSOMAL PROTEIN L2, ...
Authors:Hansen, J.L., Ippolito, J.A., Ban, N., Nissen, P., Moore, P.B., Steitz, T.
Deposit date:2001-10-23
Release date:2002-07-19
Last modified:2011-07-13
Method:X-RAY DIFFRACTION (3 Å)
Cite:The structures of four macrolide antibiotics bound to the large ribosomal subunit.
Mol.Cell, 10, 2002
1KC8
  • Download 1kc8
  • View 1kc8
Molmil generated image of 1kc8
CO-CRYSTAL STRUCTURE OF BLASTICIDIN S BOUND TO THE 50S RIBOSOMAL SUBUNIT
Descriptor:23S RRNA, 5S RRNA, RIBOSOMAL PROTEIN L2, ...
Authors:Hansen, J.L., Ban, N., Nissen, P., Moore, P.B., Steitz, T.A.
Deposit date:2001-11-07
Release date:2003-07-22
Last modified:2011-07-13
Method:X-RAY DIFFRACTION (3.01 Å)
Cite:Structures of Five Antibiotics Bound at the Peptidyl Transferase Center of the Large Ribosomal Subunit
J.Mol.Biol., 330, 2003
1MNX
  • Download 1mnx
  • View 1mnx
Molmil generated image of 1mnx
THE SOLUTION STRUCTURE OF THE LOOP E REGION OF THE 5S RRNA FROM SPINACH CHLOROPLASTS.
Descriptor:Loop E from 5S rRNA
Authors:Vallurupalli, P., Moore, P.B.
Deposit date:2002-09-06
Release date:2003-01-14
Last modified:2016-05-25
Method:SOLUTION NMR
Cite:The Solution Structure of the Loop E Region of the 5S rRNA from Spinach Chloroplasts
J.Mol.Biol., 325, 2003
1N8R
  • Download 1n8r
  • View 1n8r
Molmil generated image of 1n8r
STRUCTURE OF LARGE RIBOSOMAL SUBUNIT IN COMPLEX WITH VIRGINIAMYCIN M
Descriptor:23S ribosomal RNA, 5S ribosomal RNA, 50S ribosomal protein L2P, ...
Authors:Hansen, J.L., Moore, P.B., Steitz, T.A.
Deposit date:2002-11-21
Release date:2003-07-22
Last modified:2011-07-13
Method:X-RAY DIFFRACTION (3 Å)
Cite:Structures of Five Antibiotics Bound at the Peptidyl Transferase Center of the Large Ribosomal Subunit
J.Mol.Biol., 330, 2003
1NJI
  • Download 1nji
  • View 1nji
Molmil generated image of 1nji
STRUCTURE OF CHLORAMPHENICOL BOUND TO THE 50S RIBOSOMAL SUBUNIT
Descriptor:23S ribosomal RNA, 5S ribosomal RNA, 50S ribosomal protein L2P, ...
Authors:Hansen, J.L., Moore, P.B., Steitz, T.A.
Deposit date:2002-12-31
Release date:2003-07-22
Last modified:2011-07-13
Method:X-RAY DIFFRACTION (3 Å)
Cite:Structures of Five Antibiotics Bound at the Peptidyl Transferase Center of the Large Ribosomal Subunit
J.Mol.Biol., 330, 2003
354D
  • Download 354d
  • View 354d
Molmil generated image of 354d
STRUCTURE OF LOOP E FROM E. COLI 5S RRNA
Descriptor:RNA (5'-R(*CP*CP*GP*AP*UP*GP*GP*UP*AP*GP*UP*G)-3'), RNA-DNA (5'-R(*GP*CP*GP*AP*GP*AP*GP*UP*AP*)-D(*DGP(S)*)-R(*GP*C)-3'), MAGNESIUM ION
Authors:Correll, C.C., Freeborn, B., Moore, P.B., Steitz, T.A.
Deposit date:1997-10-01
Release date:1997-11-26
Last modified:2015-02-18
Method:X-RAY DIFFRACTION (1.5 Å)
Cite:Metals, motifs, and recognition in the crystal structure of a 5S rRNA domain.
Cell(Cambridge,Mass.), 91, 1997
357D
  • Download 357d
  • View 357d
Molmil generated image of 357d
3.5 A STRUCTURE OF FRAGMENT I FROM E. COLI 5S RRNA
Descriptor:RNA-DNA (5'-R(*UP*GP*DCP)-D(*CP(S)*)-R(*UP*GP*GP*CP*GP*GP*C)-3'), RNA (5'-R(*CP*CP*GP*AP*UP*GP*GP*UP*AP*GP*UP*GP*UP*GP*GP*GP*G*UP*C)-3'), RNA (5'-R(*CP*CP*CP*CP*AP*UP*GP*CP*GP*AP*GP*AP*GP*UP*AP*GP*G P*GP*AP*AP*CP*UP* GP*CP*CP*AP*GP*GP*CP*AP*U)-3'), ...
Authors:Correll, C.C., Freeborn, B., Moore, P.B., Steitz, T.A.
Deposit date:1997-10-09
Release date:1997-12-01
Last modified:2011-07-13
Method:X-RAY DIFFRACTION (3.5 Å)
Cite:Metals, motifs, and recognition in the crystal structure of a 5S rRNA domain.
Cell(Cambridge,Mass.), 91, 1997
364D
  • Download 364d
  • View 364d
Molmil generated image of 364d
3.0 A STRUCTURE OF FRAGMENT I FROM E. COLI 5S RRNA
Descriptor:RNA (5'-R(*UP*GP*)-D(*(1SC)P*)-R(*CP*UP*GP*GP*CP*GP*GP*C)-3'), RNA (5'-R(*CP*CP*GP*AP*UP*GP*GP*UP*AP*GP*UP*GP*UP*GP*GP*GP*G *UP*C)-3'), RNA (5'-R(*CP*CP*CP*CP*AP*UP*GP*CP*GP*AP*GP*AP*GP*UP*AP*GP*G P*GP*AP*AP*CP*UP*GP*CP*CP*AP*GP*GP*CP*AP*U)-3'), ...
Authors:Correll, C.C., Freeborn, B., Moore, P.B., Steitz, T.A.
Deposit date:1997-12-08
Release date:1998-01-02
Last modified:2011-07-13
Method:X-RAY DIFFRACTION (3 Å)
Cite:Metals, motifs, and recognition in the crystal structure of a 5S rRNA domain.
Cell(Cambridge,Mass.), 91, 1997
1C04
  • Download 1c04
  • View 1c04
Molmil generated image of 1c04
IDENTIFICATION OF KNOWN PROTEIN AND RNA STRUCTURES IN A 5 A MAP OF THE LARGE RIBOSOMAL SUBUNIT FROM HALOARCULA MARISMORTUI
Descriptor:23S RRNA FRAGMENT, RIBOSOMAL PROTEIN L2, RIBOSOMAL PROTEIN L6, ...
Authors:Ban, N., Nissen, P., Capel, M., Moore, P.B., Steitz, T.A.
Deposit date:1999-07-14
Release date:1999-08-31
Last modified:2011-07-13
Method:X-RAY DIFFRACTION (5 Å)
Cite:Placement of protein and RNA structures into a 5 A-resolution map of the 50S ribosomal subunit.
Nature, 400, 1999
1JJ2
  • Download 1jj2
  • View 1jj2
Molmil generated image of 1jj2
FULLY REFINED CRYSTAL STRUCTURE OF THE HALOARCULA MARISMORTUI LARGE RIBOSOMAL SUBUNIT AT 2.4 ANGSTROM RESOLUTION
Descriptor:23S RRNA, 5S RRNA, RIBOSOMAL PROTEIN L2, ...
Authors:Klein, D.J., Schmeing, T.M., Moore, P.B., Steitz, T.A.
Deposit date:2001-07-03
Release date:2001-08-01
Last modified:2011-07-13
Method:X-RAY DIFFRACTION (2.4 Å)
Cite:The kink-turn: a new RNA secondary structure motif.
EMBO J., 20, 2001
1SCL
  • Download 1scl
  • View 1scl
Molmil generated image of 1scl
THE SARCIN-RICIN LOOP, A MODULAR RNA
Descriptor:RNA SARCIN-RICIN LOOP
Authors:Szewczak, A.A., Moore, P.B.
Deposit date:1994-11-11
Release date:1995-01-26
Last modified:2011-07-13
Method:SOLUTION NMR
Cite:The conformation of the sarcin/ricin loop from 28S ribosomal RNA.
Proc.Natl.Acad.Sci.USA, 90, 1993
1U3K
  • Download 1u3k
  • View 1u3k
Molmil generated image of 1u3k
THE SOLUTION STRUCTURE OF A SUBSTRATE OF ARCHAEAL PRE-TRNA SPLICING ENDONUCLEASES
Descriptor:ABISS7
Authors:Pollock, E.C., Moore, P.B.
Deposit date:2004-07-22
Release date:2005-07-12
Last modified:2011-07-13
Method:SOLUTION NMR
Cite:The solution structure of a substrate of archaeal pre-tRNA splicing endonucleases
To be Published
1A4D
  • Download 1a4d
  • View 1a4d
Molmil generated image of 1a4d
LOOP D/LOOP E ARM OF ESCHERICHIA COLI 5S RRNA, NMR, MINIMIZED AVERAGE STRUCTURE
Descriptor:RNA (5'-R(*GP*GP*CP*CP*GP*AP*UP*GP*GP*UP*AP*GP*UP*GP*UP*GP*GP*GP*GP*UP*C)-3'), RNA (5'-R(P*UP*CP*CP*CP*CP*AP*UP*GP*CP*GP*AP*GP*AP*GP*UP*AP*GP*GP*CP*C)-3')
Authors:Dallas, A., Moore, P.B.
Deposit date:1998-01-29
Release date:1998-04-29
Last modified:2011-07-13
Method:SOLUTION NMR
Cite:The loop E-loop D region of Escherichia coli 5S rRNA: the solution structure reveals an unusual loop that may be important for binding ribosomal proteins.
Structure, 5, 1997
1A51
  • Download 1a51
  • View 1a51
Molmil generated image of 1a51
LOOP D/LOOP E ARM OF E. COLI 5S RRNA, NMR, 9 STRUCTURES
Descriptor:5S RRNA LOOP D/LOOP E
Authors:Dallas, A., Moore, P.B.
Deposit date:1998-02-19
Release date:1998-05-27
Last modified:2011-07-13
Method:SOLUTION NMR
Cite:The loop E-loop D region of Escherichia coli 5S rRNA: the solution structure reveals an unusual loop that may be important for binding ribosomal proteins.
Structure, 5, 1997
1A9L
  • Download 1a9l
  • View 1a9l
Molmil generated image of 1a9l
SOLUTION STRUCTURE OF A SUBSTRATE FOR THE ARCHAEAL PRE-TRNA SPLICING ENDONUCLEASES: THE BULGE-HELIX-BULGE MOTIF, NMR, 12 STRUCTURES
Descriptor:PRE-TRNA BULGE-HELIX-BULGE MOTIF
Authors:Diener, J.L., Moore, P.B.
Deposit date:1998-04-07
Release date:1998-06-17
Last modified:2011-07-13
Method:SOLUTION NMR
Cite:Solution structure of a substrate for the archaeal pre-tRNA splicing endonucleases: the bulge-helix-bulge motif.
Mol.Cell, 1, 1998
1EFG
  • Download 1efg
  • View 1efg
Molmil generated image of 1efg
THE CRYSTAL STRUCTURE OF ELONGATION FACTOR G COMPLEXED WITH GDP, AT 2.7 ANGSTROMS RESOLUTION
Descriptor:ELONGATION FACTOR G, GUANOSINE-5'-DIPHOSPHATE
Authors:Czworkowski, J., Wang, J., Steitz, T.A., Moore, P.B.
Deposit date:1994-10-17
Release date:1995-02-14
Last modified:2011-07-13
Method:X-RAY DIFFRACTION (2.7 Å)
Cite:The crystal structure of elongation factor G complexed with GDP, at 2.7 A resolution.
EMBO J., 13, 1994
1EHZ
  • Download 1ehz
  • View 1ehz
Molmil generated image of 1ehz
THE CRYSTAL STRUCTURE OF YEAST PHENYLALANINE TRNA AT 1.93 A RESOLUTION
Descriptor:TRANSFER RNA (PHE), MAGNESIUM ION, MANGANESE (II) ION
Authors:Shi, H., Moore, P.B.
Deposit date:2000-02-23
Release date:2000-10-02
Last modified:2011-12-21
Method:X-RAY DIFFRACTION (1.93 Å)
Cite:The crystal structure of yeast phenylalanine tRNA at 1.93 A resolution: a classic structure revisited
RNA, 6, 2000
1JUR
  • Download 1jur
  • View 1jur
Molmil generated image of 1jur
SOLUTION STRUCTURE OF HELIX III IN XENOPUS OOCYTE 5S RRNA.
Descriptor:5'-R(*GP*GP*CP*CP*UP*GP*AP*GP*GP*AP*GP*AP*CP*UP*CP*AP*GP*AP*AP*GP*CP*C)-3'
Authors:Huber, P.W., Rife, J.P., Moore, P.B.
Deposit date:2001-08-26
Release date:2002-01-16
Last modified:2011-07-13
Method:SOLUTION NMR
Cite:The structure of helix III in Xenopus oocyte 5 S rRNA: an RNA stem containing a two-nucleotide bulge.
J.Mol.Biol., 312, 2001
1K9M
  • Download 1k9m
  • View 1k9m
Molmil generated image of 1k9m
CO-CRYSTAL STRUCTURE OF TYLOSIN BOUND TO THE 50S RIBOSOMAL SUBUNIT OF HALOARCULA MARISMORTUI
Descriptor:23S RRNA, 5S RRNA, RIBOSOMAL PROTEIN L2, ...
Authors:Hansen, J.L., Ippolito, J.A., Ban, N., Nissen, P., Moore, P.B., Steitz, T.A.
Deposit date:2001-10-29
Release date:2002-07-19
Last modified:2011-07-13
Method:X-RAY DIFFRACTION (3 Å)
Cite:The structures of four macrolide antibiotics bound to the large ribosomal subunit.
Mol.Cell, 10, 2002
1KD1
  • Download 1kd1
  • View 1kd1
Molmil generated image of 1kd1
CO-CRYSTAL STRUCTURE OF SPIRAMYCIN BOUND TO THE 50S RIBOSOMAL SUBUNIT OF HALOARCULA MARISMORTUI
Descriptor:23S RRNA, 5S RRNA, RIBOSOMAL PROTEIN L2, ...
Authors:Hansen, J.L., Ippolito, J.A., Ban, N., Nissen, P., Moore, P.B., Steitz, T.A.
Deposit date:2001-11-12
Release date:2002-07-19
Last modified:2011-07-13
Method:X-RAY DIFFRACTION (3 Å)
Cite:The structures of four macrolide antibiotics bound to the large ribosomal subunit.
Mol.Cell, 10, 2002
1KQS
  • Download 1kqs
  • View 1kqs
Molmil generated image of 1kqs
THE HALOARCULA MARISMORTUI 50S COMPLEXED WITH A PRETRANSLOCATIONAL INTERMEDIATE IN PROTEIN SYNTHESIS
Descriptor:23S RRNA, 5S RRNA, CCA, ...
Authors:Schmeing, T.M., Seila, A.C., Hansen, J.L., Freeborn, B., Soukup, J.K., Scaringe, S.A., Strobel, S.A., Moore, P.B., Steitz, T.A.
Deposit date:2002-01-07
Release date:2002-02-22
Last modified:2011-07-13
Method:X-RAY DIFFRACTION (3.1 Å)
Cite:A pre-translocational intermediate in protein synthesis observed in crystals of enzymatically active 50S subunits.
Nat.Struct.Biol., 9, 2002