Author results

1K73
  • Download 1k73
  • View 1k73
Molmil generated image of 1k73
CO-CRYSTAL STRUCTURE OF ANISOMYCIN BOUND TO THE 50S RIBOSOMAL SUBUNIT
Descriptor:23S RRNA, 5S RRNA, RIBOSOMAL PROTEIN L2, ...
Authors:Hansen, J., Ban, N., Nissen, P., Moore, P.B., Steitz, T.A.
Deposit date:2001-10-18
Release date:2003-07-22
Last modified:2011-07-13
Method:X-RAY DIFFRACTION (3.01 Å)
Cite:Structures of Five Antibiotics Bound at the Peptidyl Transferase Center of the Large Ribosomal Subunit
J.Mol.Biol., 330, 2003
1FFK
  • Download 1ffk
  • View 1ffk
Molmil generated image of 1ffk
CRYSTAL STRUCTURE OF THE LARGE RIBOSOMAL SUBUNIT FROM HALOARCULA MARISMORTUI AT 2.4 ANGSTROM RESOLUTION
Descriptor:23S RRNA, 5S RRNA, RIBOSOMAL PROTEIN L2, ...
Authors:Ban, N., Nissen, P., Hansen, J., Moore, P.B., Steitz, T.A.
Deposit date:2000-07-25
Release date:2000-08-14
Last modified:2011-07-13
Method:X-RAY DIFFRACTION (2.4 Å)
Cite:The complete atomic structure of the large ribosomal subunit at 2.4 A resolution.
Science, 289, 2000
1FFZ
  • Download 1ffz
  • View 1ffz
Molmil generated image of 1ffz
LARGE RIBOSOMAL SUBUNIT COMPLEXED WITH R(CC)-DA-PUROMYCIN
Descriptor:23S RIBOSOMAL RNA, R(P*CP*C*)-D(P*A)-R(P*(PU))
Authors:Nissen, P., Hansen, J., Ban, N., Moore, P.B., Steitz, T.A.
Deposit date:2000-07-26
Release date:2000-08-28
Last modified:2011-07-13
Method:X-RAY DIFFRACTION (3.2 Å)
Cite:The structural basis of ribosome activity in peptide bond synthesis.
Science, 289, 2000
1FG0
  • Download 1fg0
  • View 1fg0
Molmil generated image of 1fg0
LARGE RIBOSOMAL SUBUNIT COMPLEXED WITH A 13 BP MINIHELIX-PUROMYCIN COMPOUND
Descriptor:23S RIBOSOMAL RNA, 5'-R(CCGGCGGGCUGGUUCAAACCGGCCCGCCGGACC)-3'-5'-R(P-PUROMYCIN)-3'
Authors:Nissen, P., Hansen, J., Ban, N., Moore, P.B., Steitz, T.A.
Deposit date:2000-07-26
Release date:2000-08-28
Last modified:2011-07-13
Method:X-RAY DIFFRACTION (3 Å)
Cite:The structural basis of ribosome activity in peptide bond synthesis.
Science, 289, 2000
1KC8
  • Download 1kc8
  • View 1kc8
Molmil generated image of 1kc8
CO-CRYSTAL STRUCTURE OF BLASTICIDIN S BOUND TO THE 50S RIBOSOMAL SUBUNIT
Descriptor:23S RRNA, 5S RRNA, RIBOSOMAL PROTEIN L2, ...
Authors:Hansen, J.L., Ban, N., Nissen, P., Moore, P.B., Steitz, T.A.
Deposit date:2001-11-07
Release date:2003-07-22
Last modified:2011-07-13
Method:X-RAY DIFFRACTION (3.01 Å)
Cite:Structures of Five Antibiotics Bound at the Peptidyl Transferase Center of the Large Ribosomal Subunit
J.Mol.Biol., 330, 2003
1N8R
  • Download 1n8r
  • View 1n8r
Molmil generated image of 1n8r
STRUCTURE OF LARGE RIBOSOMAL SUBUNIT IN COMPLEX WITH VIRGINIAMYCIN M
Descriptor:23S ribosomal RNA, 5S ribosomal RNA, 50S ribosomal protein L2P, ...
Authors:Hansen, J.L., Moore, P.B., Steitz, T.A.
Deposit date:2002-11-21
Release date:2003-07-22
Last modified:2011-07-13
Method:X-RAY DIFFRACTION (3 Å)
Cite:Structures of Five Antibiotics Bound at the Peptidyl Transferase Center of the Large Ribosomal Subunit
J.Mol.Biol., 330, 2003
1NJI
  • Download 1nji
  • View 1nji
Molmil generated image of 1nji
STRUCTURE OF CHLORAMPHENICOL BOUND TO THE 50S RIBOSOMAL SUBUNIT
Descriptor:23S ribosomal RNA, 5S ribosomal RNA, 50S ribosomal protein L2P, ...
Authors:Hansen, J.L., Moore, P.B., Steitz, T.A.
Deposit date:2002-12-31
Release date:2003-07-22
Last modified:2011-07-13
Method:X-RAY DIFFRACTION (3 Å)
Cite:Structures of Five Antibiotics Bound at the Peptidyl Transferase Center of the Large Ribosomal Subunit
J.Mol.Biol., 330, 2003
1RDR
  • Download 1rdr
  • View 1rdr
Molmil generated image of 1rdr
POLIOVIRUS 3D POLYMERASE
Descriptor:POLIOVIRUS 3D POLYMERASE, CALCIUM ION
Authors:Hansen, J., Long, A., Schultz, S.
Deposit date:1998-04-28
Release date:1998-09-16
Last modified:2011-07-13
Method:X-RAY DIFFRACTION (2.4 Å)
Cite:Structure of the RNA-dependent RNA polymerase of poliovirus.
Structure, 5, 1997
1K8A
  • Download 1k8a
  • View 1k8a
Molmil generated image of 1k8a
CO-CRYSTAL STRUCTURE OF CARBOMYCIN A BOUND TO THE 50S RIBOSOMAL SUBUNIT OF HALOARCULA MARISMORTUI
Descriptor:23S RRNA, 5S RRNA, RIBOSOMAL PROTEIN L2, ...
Authors:Hansen, J.L., Ippolito, J.A., Ban, N., Nissen, P., Moore, P.B., Steitz, T.
Deposit date:2001-10-23
Release date:2002-07-19
Last modified:2011-07-13
Method:X-RAY DIFFRACTION (3 Å)
Cite:The structures of four macrolide antibiotics bound to the large ribosomal subunit.
Mol.Cell, 10, 2002
3C1B
  • Download 3c1b
  • View 3c1b
Molmil generated image of 3c1b
THE EFFECT OF H3 K79 DIMETHYLATION AND H4 K20 TRIMETHYLATION ON NUCLEOSOME AND CHROMATIN STRUCTURE
Descriptor:Histone H3-like, Histone H4, Histone H2A type 1, ...
Authors:Lu, X., Simon, M., Chodaparambil, J., Hansen, J., Shokat, K., Luger, K.
Deposit date:2008-01-22
Release date:2008-10-07
Last modified:2011-07-13
Method:X-RAY DIFFRACTION (2.2 Å)
Cite:The effect of H3K79 dimethylation and H4K20 trimethylation on nucleosome and chromatin structure.
Nat.Struct.Mol.Biol., 15, 2008
3C1C
  • Download 3c1c
  • View 3c1c
Molmil generated image of 3c1c
THE EFFECT OF H3 K79 DIMETHYLATION AND H4 K20 TRIMETHYLATION ON NUCLEOSOME AND CHROMATIN STRUCTURE
Descriptor:Histone H3-like, Histone H4, Histone H2A type 1, ...
Authors:Lu, X., Simon, M., Chodaparambil, J., Hansen, J., Shokat, K., Luger, K.
Deposit date:2008-01-22
Release date:2008-10-07
Last modified:2011-07-13
Method:X-RAY DIFFRACTION (3.15 Å)
Cite:The effect of H3K79 dimethylation and H4K20 trimethylation on nucleosome and chromatin structure.
Nat.Struct.Mol.Biol., 15, 2008
1C04
  • Download 1c04
  • View 1c04
Molmil generated image of 1c04
IDENTIFICATION OF KNOWN PROTEIN AND RNA STRUCTURES IN A 5 A MAP OF THE LARGE RIBOSOMAL SUBUNIT FROM HALOARCULA MARISMORTUI
Descriptor:23S RRNA FRAGMENT, RIBOSOMAL PROTEIN L2, RIBOSOMAL PROTEIN L6, ...
Authors:Ban, N., Nissen, P., Capel, M., Moore, P.B., Steitz, T.A.
Deposit date:1999-07-14
Release date:1999-08-31
Last modified:2011-07-13
Method:X-RAY DIFFRACTION (5 Å)
Cite:Placement of protein and RNA structures into a 5 A-resolution map of the 50S ribosomal subunit.
Nature, 400, 1999
4YMA
  • Download 4yma
  • View 4yma
Molmil generated image of 4yma
STRUCTURE OF THE LIGAND-BINDING DOMAIN OF GLUA2 IN COMPLEX WITH THE ANTAGONIST CNG10109
Descriptor:Glutamate receptor 2, SULFATE ION, GLYCEROL, ...
Authors:Moller, C., Tapken, D., Kastrup, J.S., Frydenvang, K.
Deposit date:2015-03-06
Release date:2015-08-05
Last modified:2018-03-07
Method:X-RAY DIFFRACTION (1.895 Å)
Cite:Structure-Activity Relationship Study of Ionotropic Glutamate Receptor Antagonist (2S,3R)-3-(3-Carboxyphenyl)pyrrolidine-2-carboxylic Acid.
J.Med.Chem., 58, 2015
4YMB
  • Download 4ymb
  • View 4ymb
Molmil generated image of 4ymb
STRUCTURE OF THE LIGAND-BINDING DOMAIN OF GLUK1 IN COMPLEX WITH THE ANTAGONIST CNG10111
Descriptor:Glutamate receptor ionotropic, kainate 1,Glutamate receptor ionotropic, kainate 1, ...
Authors:Moller, C., Tapken, D., Kastrup, J.S., Frydenvang, K.
Deposit date:2015-03-06
Release date:2015-08-05
Last modified:2017-08-09
Method:X-RAY DIFFRACTION (1.93 Å)
Cite:Structure-Activity Relationship Study of Ionotropic Glutamate Receptor Antagonist (2S,3R)-3-(3-Carboxyphenyl)pyrrolidine-2-carboxylic Acid.
J.Med.Chem., 58, 2015
5JYG
  • Download 5jyg
  • View 5jyg
Molmil generated image of 5jyg
CRYO-EM STRUCTURE OF THE MAMK FILAMENT AT 6.5 A
Descriptor:Actin-like ATPase, MAGNESIUM ION, ADENOSINE-5'-DIPHOSPHATE
Authors:Bergeron, J.R.C., Hutto, R., Kollman, J.M.
Deposit date:2016-05-13
Release date:2016-07-27
Last modified:2017-01-11
Method:ELECTRON MICROSCOPY (6.5 Å)
Cite:Structure of the magnetosome-associated actin-like MamK filament at subnanometer resolution.
Protein Sci., 26, 2017
4V4B
  • Download 4v4b
  • View 4v4b
Molmil generated image of 4v4b
STRUCTURE OF THE RIBOSOMAL 80S-EEF2-SORDARIN COMPLEX FROM YEAST OBTAINED BY DOCKING ATOMIC MODELS FOR RNA AND PROTEIN COMPONENTS INTO A 11.7 A CRYO-EM MAP.
Descriptor:18S ribosomal RNA, Elongation factor 2, 40S ribosomal protein S0-A, ...
Authors:Spahn, C.M., Gomez-Lorenzo, M.G., Grassucci, R.A., Jorgensen, R., Andersen, G.R., Beckmann, R., Penczek, P.A., Ballesta, J.P.G., Frank, J.
Deposit date:2004-01-06
Release date:2014-07-09
Last modified:2015-03-18
Method:ELECTRON MICROSCOPY (11.7 Å)
Cite:Domain movements of elongation factor eEF2 and the eukaryotic 80S ribosome facilitate tRNA translocation.
Embo J., 23, 2004
1GO0
  • Download 1go0
  • View 1go0
Molmil generated image of 1go0
NMR STRUCTURE OF RIBOSOMAL PROTEIN L30E FROM THERMOCOCCUS CELER
Descriptor:50S RIBOSOMAL PROTEIN L30E
Authors:Chan, S.-H., Bycroft, M., Freund, S.M.V., Wong, K.-B.
Deposit date:2001-10-15
Release date:2003-06-12
Last modified:2018-01-24
Method:SOLUTION NMR
Cite:Solution Structure and Thermal Stability of Ribosomal Protein L30E from Hyperthermophilic Archaeon Thermococcus Celer
Protein Sci., 12, 2003
1GO1
  • Download 1go1
  • View 1go1
Molmil generated image of 1go1
NMR STRUCTURE OF RIBOSOMAL PROTEIN L30E FROM THERMOCOCCUS CELER.
Descriptor:50S RIBOSOMAL PROTEIN L30E
Authors:Chan, S.-H., Bycroft, M., Freund, S.M.V., Wong, K.-B.
Deposit date:2001-10-15
Release date:2003-06-12
Last modified:2018-01-24
Method:SOLUTION NMR
Cite:Solution Structure and Thermal Stability of Ribosomal Protein L30E from Hyperthermophilic Archaeon Thermococcus Celer
Protein Sci., 12, 2003
1H7M
  • Download 1h7m
  • View 1h7m
Molmil generated image of 1h7m
RIBOSOMAL PROTEIN L30E FROM THERMOCOCCUS CELER
Descriptor:50S RIBOSOMAL PROTEIN L30E
Authors:Chen, Y.W., Wong, K.B.
Deposit date:2001-07-09
Release date:2003-04-04
Last modified:2018-01-24
Method:X-RAY DIFFRACTION (1.96 Å)
Cite:Crystal Structure of Ribosomal Protein L30E from the Extreme Thermophile Thermocccus Celer: Thermal Stability and RNA Binding
Biochemistry, 42, 2003
4V9F
  • Download 4v9f
  • View 4v9f
Molmil generated image of 4v9f
THE RE-REFINED CRYSTAL STRUCTURE OF THE HALOARCULA MARISMORTUI LARGE RIBOSOMAL SUBUNIT AT 2.4 ANGSTROM RESOLUTION: MORE COMPLETE STRUCTURE OF THE L7/L12 AND L1 STALK, L5 AND LX PROTEINS
Descriptor:23S Ribosomal RNA, 5S Ribosomal RNA, 50S ribosomal protein L2P, ...
Authors:Gabdulkhakov, A.
Deposit date:2012-11-02
Release date:2014-07-09
Last modified:2017-06-28
Method:X-RAY DIFFRACTION (2.404 Å)
Cite:Revisiting the Haloarcula marismortui 50S ribosomal subunit model.
Acta Crystallogr.,Sect.D, 69, 2013