1K73
| Co-crystal Structure of Anisomycin Bound to the 50S Ribosomal Subunit | Descriptor: | 23S RRNA, 5S RRNA, ANISOMYCIN, ... | Authors: | Hansen, J, Ban, N, Nissen, P, Moore, P.B, Steitz, T.A. | Deposit date: | 2001-10-18 | Release date: | 2003-07-22 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (3.01 Å) | Cite: | Structures of Five Antibiotics Bound at the Peptidyl Transferase Center of
the Large Ribosomal Subunit J.Mol.Biol., 330, 2003
|
|
1FFK
| CRYSTAL STRUCTURE OF THE LARGE RIBOSOMAL SUBUNIT FROM HALOARCULA MARISMORTUI AT 2.4 ANGSTROM RESOLUTION | Descriptor: | 23S RRNA, 5S RRNA, CADMIUM ION, ... | Authors: | Ban, N, Nissen, P, Hansen, J, Moore, P.B, Steitz, T.A. | Deposit date: | 2000-07-25 | Release date: | 2000-08-14 | Last modified: | 2024-02-07 | Method: | X-RAY DIFFRACTION (2.4 Å) | Cite: | The complete atomic structure of the large ribosomal subunit at 2.4 A resolution. Science, 289, 2000
|
|
1FFZ
| LARGE RIBOSOMAL SUBUNIT COMPLEXED WITH R(CC)-DA-PUROMYCIN | Descriptor: | 23S RIBOSOMAL RNA, R(P*CP*C*)-D(P*A)-R(P*(PU)) | Authors: | Nissen, P, Hansen, J, Ban, N, Moore, P.B, Steitz, T.A. | Deposit date: | 2000-07-26 | Release date: | 2000-08-28 | Last modified: | 2024-02-07 | Method: | X-RAY DIFFRACTION (3.2 Å) | Cite: | The structural basis of ribosome activity in peptide bond synthesis. Science, 289, 2000
|
|
1FG0
| LARGE RIBOSOMAL SUBUNIT COMPLEXED WITH A 13 BP MINIHELIX-PUROMYCIN COMPOUND | Descriptor: | 23S RIBOSOMAL RNA, 5'-R(CCGGCGGGCUGGUUCAAACCGGCCCGCCGGACC)-3'-5'-R(P-PUROMYCIN)-3' | Authors: | Nissen, P, Hansen, J, Ban, N, Moore, P.B, Steitz, T.A. | Deposit date: | 2000-07-26 | Release date: | 2000-08-28 | Last modified: | 2024-02-07 | Method: | X-RAY DIFFRACTION (3 Å) | Cite: | The structural basis of ribosome activity in peptide bond synthesis. Science, 289, 2000
|
|
6XDG
| Complex of SARS-CoV-2 receptor binding domain with the Fab fragments of two neutralizing antibodies | Descriptor: | REGN10933 antibody Fab fragment heavy chain, REGN10933 antibody Fab fragment light chain, REGN10987 antibody Fab fragment heavy chain, ... | Authors: | Franklin, M.C, Saotome, K, Romero Hernandez, A, Zhou, Y. | Deposit date: | 2020-06-10 | Release date: | 2020-06-24 | Last modified: | 2021-01-27 | Method: | ELECTRON MICROSCOPY (3.9 Å) | Cite: | Studies in humanized mice and convalescent humans yield a SARS-CoV-2 antibody cocktail. Science, 369, 2020
|
|
1KC8
| Co-crystal Structure of Blasticidin S Bound to the 50S Ribosomal Subunit | Descriptor: | 23S RRNA, 5S RRNA, BLASTICIDIN S, ... | Authors: | Hansen, J.L, Ban, N, Nissen, P, Moore, P.B, Steitz, T.A. | Deposit date: | 2001-11-07 | Release date: | 2003-07-22 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (3.01 Å) | Cite: | Structures of Five Antibiotics Bound at the Peptidyl Transferase Center of
the Large Ribosomal Subunit J.Mol.Biol., 330, 2003
|
|
1N8R
| Structure of large ribosomal subunit in complex with virginiamycin M | Descriptor: | 23S ribosomal RNA, 50S ribosomal protein L10e, 50S ribosomal protein L13P, ... | Authors: | Hansen, J.L, Moore, P.B, Steitz, T.A. | Deposit date: | 2002-11-21 | Release date: | 2003-07-22 | Last modified: | 2024-03-13 | Method: | X-RAY DIFFRACTION (3 Å) | Cite: | Structures of Five Antibiotics Bound at the Peptidyl Transferase Center of
the Large Ribosomal Subunit J.Mol.Biol., 330, 2003
|
|
1NJI
| Structure of chloramphenicol bound to the 50S ribosomal subunit | Descriptor: | 23S ribosomal RNA, 50S ribosomal protein L10e, 50S ribosomal protein L13P, ... | Authors: | Hansen, J.L, Moore, P.B, Steitz, T.A. | Deposit date: | 2002-12-31 | Release date: | 2003-07-22 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (3 Å) | Cite: | Structures of Five Antibiotics Bound at the Peptidyl Transferase Center of
the Large Ribosomal Subunit J.Mol.Biol., 330, 2003
|
|
1RDR
| POLIOVIRUS 3D POLYMERASE | Descriptor: | CALCIUM ION, POLIOVIRUS 3D POLYMERASE | Authors: | Hansen, J, Long, A, Schultz, S. | Deposit date: | 1998-04-28 | Release date: | 1998-09-16 | Last modified: | 2024-02-14 | Method: | X-RAY DIFFRACTION (2.4 Å) | Cite: | Structure of the RNA-dependent RNA polymerase of poliovirus. Structure, 5, 1997
|
|
3C1B
| The effect of H3 K79 dimethylation and H4 K20 trimethylation on nucleosome and chromatin structure | Descriptor: | Histone 2, H2bf, Histone H2A type 1, ... | Authors: | Lu, X, Simon, M, Chodaparambil, J, Hansen, J, Shokat, K, Luger, K. | Deposit date: | 2008-01-22 | Release date: | 2008-10-07 | Last modified: | 2023-11-15 | Method: | X-RAY DIFFRACTION (2.2 Å) | Cite: | The effect of H3K79 dimethylation and H4K20 trimethylation on nucleosome and chromatin structure. Nat.Struct.Mol.Biol., 15, 2008
|
|
3C1C
| The effect of H3 K79 dimethylation and H4 K20 trimethylation on nucleosome and chromatin structure | Descriptor: | Histone 2, H2bf, Histone H2A type 1, ... | Authors: | Lu, X, Simon, M, Chodaparambil, J, Hansen, J, Shokat, K, Luger, K. | Deposit date: | 2008-01-22 | Release date: | 2008-10-07 | Last modified: | 2023-11-15 | Method: | X-RAY DIFFRACTION (3.15 Å) | Cite: | The effect of H3K79 dimethylation and H4K20 trimethylation on nucleosome and chromatin structure. Nat.Struct.Mol.Biol., 15, 2008
|
|
6XK9
| Cereblon in complex with DDB1, CC-90009, and GSPT1 | Descriptor: | 2-(4-chlorophenyl)-N-({2-[(3S)-2,6-dioxopiperidin-3-yl]-1-oxo-2,3-dihydro-1H-isoindol-5-yl}methyl)-2,2-difluoroacetamide, DNA damage-binding protein 1, Eukaryotic peptide chain release factor GTP-binding subunit ERF3A, ... | Authors: | Clayton, T.L, Tran, E.T, Zhu, J, Pagarigan, B.E, Matyskiela, M.E, Chamberlain, P.P. | Deposit date: | 2020-06-25 | Release date: | 2020-12-02 | Last modified: | 2023-10-18 | Method: | X-RAY DIFFRACTION (3.64 Å) | Cite: | CC-90009, a novel cereblon E3 ligase modulator, targets acute myeloid leukemia blasts and leukemia stem cells. Blood, 137, 2021
|
|
4V4B
| Structure of the ribosomal 80S-eEF2-sordarin complex from yeast obtained by docking atomic models for RNA and protein components into a 11.7 A cryo-EM map. | Descriptor: | 18S ribosomal RNA, 40S ribosomal protein S0-A, 40S ribosomal protein S11, ... | Authors: | Spahn, C.M, Gomez-Lorenzo, M.G, Grassucci, R.A, Jorgensen, R, Andersen, G.R, Beckmann, R, Penczek, P.A, Ballesta, J.P.G, Frank, J. | Deposit date: | 2004-01-06 | Release date: | 2014-07-09 | Last modified: | 2024-02-28 | Method: | ELECTRON MICROSCOPY (11.7 Å) | Cite: | Domain movements of elongation factor eEF2 and the eukaryotic 80S ribosome facilitate tRNA translocation. Embo J., 23, 2004
|
|
1C04
| IDENTIFICATION OF KNOWN PROTEIN AND RNA STRUCTURES IN A 5 A MAP OF THE LARGE RIBOSOMAL SUBUNIT FROM HALOARCULA MARISMORTUI | Descriptor: | 23S RRNA FRAGMENT, RIBOSOMAL PROTEIN L11, RIBOSOMAL PROTEIN L14, ... | Authors: | Ban, N, Nissen, P, Capel, M, Moore, P.B, Steitz, T.A. | Deposit date: | 1999-07-14 | Release date: | 1999-08-31 | Last modified: | 2011-07-13 | Method: | X-RAY DIFFRACTION (5 Å) | Cite: | Placement of protein and RNA structures into a 5 A-resolution map of the 50S ribosomal subunit. Nature, 400, 1999
|
|
4V9F
| |
6PYD
| Structure of 3E9 antibody Fab bound to marinobufagenin | Descriptor: | (3beta,5beta,14alpha,15beta)-3,5-dihydroxy-14,15-epoxybufa-20,22-dienolide, 3E9 anti-marinobufagenin antibody Fab heavy chain, recloned with human IgG4 C region, ... | Authors: | Franklin, M.C, Macdonald, L.E, McWhirter, J, Murphy, A.J. | Deposit date: | 2019-07-29 | Release date: | 2019-12-25 | Last modified: | 2023-10-11 | Method: | X-RAY DIFFRACTION (2 Å) | Cite: | Kappa-on-Heavy (KoH) bodies are a distinct class of fully-human antibody-like therapeutic agents with antigen-binding properties. Proc.Natl.Acad.Sci.USA, 117, 2020
|
|
6PYC
| Structure of kappa-on-heavy (KoH) antibody Fab bound to the cardiac hormone marinobufagenin | Descriptor: | (3beta,5beta,14alpha,15beta)-3,5-dihydroxy-14,15-epoxybufa-20,22-dienolide, KoH body Fab heavy chain, KoH body Fab light chain, ... | Authors: | Franklin, M.C, Macdonald, L.E, McWhirter, J, Murphy, A.J. | Deposit date: | 2019-07-29 | Release date: | 2019-12-25 | Last modified: | 2023-10-11 | Method: | X-RAY DIFFRACTION (3.6 Å) | Cite: | Kappa-on-Heavy (KoH) bodies are a distinct class of fully-human antibody-like therapeutic agents with antigen-binding properties. Proc.Natl.Acad.Sci.USA, 117, 2020
|
|
4YMA
| Structure of the ligand-binding domain of GluA2 in complex with the antagonist CNG10109 | Descriptor: | (3R)-3-(3-carboxy-5-hydroxyphenyl)-L-proline, 1,2-ETHANEDIOL, ACETATE ION, ... | Authors: | Moller, C, Tapken, D, Kastrup, J.S, Frydenvang, K. | Deposit date: | 2015-03-06 | Release date: | 2015-08-05 | Last modified: | 2024-01-10 | Method: | X-RAY DIFFRACTION (1.895 Å) | Cite: | Structure-Activity Relationship Study of Ionotropic Glutamate Receptor Antagonist (2S,3R)-3-(3-Carboxyphenyl)pyrrolidine-2-carboxylic Acid. J.Med.Chem., 58, 2015
|
|
4YMB
| Structure of the ligand-binding domain of GluK1 in complex with the antagonist CNG10111 | Descriptor: | (3R,4S)-3-(3-carboxyphenyl)-4-propyl-L-proline, 1,2-ETHANEDIOL, ACETATE ION, ... | Authors: | Moller, C, Tapken, D, Kastrup, J.S, Frydenvang, K. | Deposit date: | 2015-03-06 | Release date: | 2015-08-05 | Last modified: | 2024-01-10 | Method: | X-RAY DIFFRACTION (1.93 Å) | Cite: | Structure-Activity Relationship Study of Ionotropic Glutamate Receptor Antagonist (2S,3R)-3-(3-Carboxyphenyl)pyrrolidine-2-carboxylic Acid. J.Med.Chem., 58, 2015
|
|
5JYG
| |
1K8A
| Co-crystal structure of Carbomycin A bound to the 50S ribosomal subunit of Haloarcula marismortui | Descriptor: | 23S RRNA, 5S RRNA, CADMIUM ION, ... | Authors: | Hansen, J.L, Ippolito, J.A, Ban, N, Nissen, P, Moore, P.B, Steitz, T. | Deposit date: | 2001-10-23 | Release date: | 2002-07-19 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (3 Å) | Cite: | The structures of four macrolide antibiotics bound to the large ribosomal subunit. Mol.Cell, 10, 2002
|
|
1GO0
| |
1H7M
| Ribosomal Protein L30e from Thermococcus celer | Descriptor: | 50S RIBOSOMAL PROTEIN L30E | Authors: | Chen, Y.W, Wong, K.B. | Deposit date: | 2001-07-09 | Release date: | 2003-04-04 | Last modified: | 2018-01-24 | Method: | X-RAY DIFFRACTION (1.96 Å) | Cite: | Crystal Structure of Ribosomal Protein L30E from the Extreme Thermophile Thermocccus Celer: Thermal Stability and RNA Binding Biochemistry, 42, 2003
|
|
1GO1
| |