1QWB
 
 | |
1QWA
 | | NMR structure of 5'-r(GGAUGCCUCCCGAGUGCAUCC): an RNA hairpin derived from the mouse 5'ETS that binds nucleolin RBD12. | | Descriptor: | 18S ribosomal RNA, 5'ETS | | Authors: | Finger, L.D, Trantirek, L, Johansson, C, Feigon, J. | | Deposit date: | 2003-09-01 | | Release date: | 2003-11-25 | | Last modified: | 2021-04-07 | | Method: | SOLUTION NMR | | Cite: | Solution Strucutres of Stem-loop RNAs that Bind to the Two N-terminal RNA Binding Domains of Nucleolin
Nucleic Acids Res., 31, 2003
|
|
1Q75
 | |
1IE2
 | | Solution Structure of an In Vitro Selected RNA which is Sequence Specifically Recognized by RBD12 of Hamster Nucleolin.sNRE (anti) | | Descriptor: | 5'-R(*GP*GP*CP*CP*GP*AP*AP*AP*UP*CP*CP*CP*GP*AP*AP*GP*UP*AP*GP*GP*CP*C)-3' | | Authors: | Bouvet, P, Allain, F.H.-T, Finger, L.D, Dieckmann, T, Feigon, J. | | Deposit date: | 2001-04-05 | | Release date: | 2001-06-20 | | Last modified: | 2022-02-23 | | Method: | SOLUTION NMR | | Cite: | Recognition of pre-formed and flexible elements of an RNA stem-loop by nucleolin.
J.Mol.Biol., 309, 2001
|
|
1IE1
 | | NMR Solution Structure of an In Vitro Selected RNA which is Sequence Specifically Recognized by Hamster Nucleolin RBD12. | | Descriptor: | 5'-R(*GP*GP*CP*CP*GP*AP*AP*AP*UP*CP*CP*CP*GP*AP*AP*GP*UP*AP*GP*GP*CP*C)-3' | | Authors: | Bouvet, P, Allain, F.H.-T, Finger, L.D, Dieckmann, T, Feigon, J. | | Deposit date: | 2001-04-05 | | Release date: | 2001-06-20 | | Last modified: | 2017-02-01 | | Method: | SOLUTION NMR | | Cite: | Recognition of pre-formed and flexible elements of an RNA stem-loop by nucleolin.
J.Mol.Biol., 309, 2001
|
|
5FV7
 | | Human Fen1 in complex with an N-hydroxyurea compound | | Descriptor: | 1-[(2S)-2,3-dihydro-1,4-benzodioxin-2-ylmethyl]-3-hydroxythieno[3,2-d]pyrimidine-2,4(1H,3H)-dione, FLAP ENDONUCLEASE 1, MAGNESIUM ION | | Authors: | Exell, J.C, Thompson, M.J, Finger, L.D, Shaw, S.K, Abbott, W.M, McWhirter, C, Debreczeni, J.E, Jones, C.D, Nissink, J.W.M, Ward, T.A, Sioberg, C.W.L, Molina, D.M, Durant, S.T, Grasby, J.A. | | Deposit date: | 2016-02-03 | | Release date: | 2016-08-17 | | Last modified: | 2017-08-23 | | Method: | X-RAY DIFFRACTION (2.84 Å) | | Cite: | Cellular Active N-Hydroxyurea Fen1 Inhibitors Block Substrate Entry to the Active Site
Nat.Chem.Biol., 12, 2016
|
|
1NA2
 | |
1RKJ
 | | Solution structure of the complex formed by the two N-terminal RNA-binding domains of nucleolin and a pre-rRNA target | | Descriptor: | 5'-R(*GP*GP*AP*UP*GP*CP*CP*UP*CP*CP*CP*GP*AP*GP*UP*GP*CP*AP*UP*CP*C)-3', Nucleolin | | Authors: | Johansson, C, Finger, L.D, Trantirek, L, Mueller, T.D, Kim, S, Laird-Offringa, I.A, Feigon, J. | | Deposit date: | 2003-11-21 | | Release date: | 2004-04-27 | | Last modified: | 2022-03-02 | | Method: | SOLUTION NMR | | Cite: | Solution structure of the complex formed by the two N-terminal RNA-binding domains of nucleolin and a pre-rRNA target.
J.Mol.Biol., 337, 2004
|
|
3Q8K
 | | Crystal Structure of Human Flap Endonuclease FEN1 (WT) in complex with product 5'-flap DNA, SM3+, and K+ | | Descriptor: | DNA (5'-D(*AP*CP*CP*GP*TP*CP*C)-3'), DNA (5'-D(*AP*CP*TP*CP*TP*GP*CP*CP*TP*CP*AP*AP*GP*AP*CP*GP*GP*T)-3'), DNA (5'-D(P*TP*GP*AP*GP*GP*CP*AP*GP*AP*GP*T)-3'), ... | | Authors: | Tsutakawa, S.E, Classen, S, Chapados, B.R, Arvai, A, Finger, D.L, Guenther, G, Tomlinson, C.G, Thompson, P, Sarker, A.H, Shen, B, Cooper, P.K, Grasby, J.A, Tainer, J.A. | | Deposit date: | 2011-01-06 | | Release date: | 2011-04-27 | | Last modified: | 2023-09-13 | | Method: | X-RAY DIFFRACTION (2.2001 Å) | | Cite: | Human Flap Endonuclease Structures, DNA Double-Base Flipping, and a Unified Understanding of the FEN1 Superfamily.
Cell(Cambridge,Mass.), 145, 2011
|
|
3Q8M
 | | Crystal Structure of Human Flap Endonuclease FEN1 (D181A) in complex with substrate 5'-flap DNA and K+ | | Descriptor: | DNA (5'-D(*AP*CP*CP*GP*TP*CP*C)-3'), DNA (5'-D(*AP*CP*TP*CP*TP*GP*CP*CP*TP*CP*AP*AP*GP*AP*CP*GP*GP*T)-3'), DNA (5'-D(*TP*TP*GP*AP*GP*GP*CP*AP*GP*AP*GP*T)-3'), ... | | Authors: | Tsutakawa, S.E, Classen, S, Chapados, B.R, Arvai, A, Finger, D.L, Guenther, G, Tomlinson, C.G, Thompson, P, Sarker, A.H, Shen, B, Cooper, P.K, Grasby, J.A, Tainer, J.A. | | Deposit date: | 2011-01-06 | | Release date: | 2011-04-27 | | Last modified: | 2023-09-13 | | Method: | X-RAY DIFFRACTION (2.6 Å) | | Cite: | Human Flap Endonuclease Structures, DNA Double-Base Flipping, and a Unified Understanding of the FEN1 Superfamily.
Cell(Cambridge,Mass.), 145, 2011
|
|
3Q8L
 | | Crystal Structure of Human Flap Endonuclease FEN1 (WT) in complex with substrate 5'-flap DNA, SM3+, and K+ | | Descriptor: | DNA (5'-D(*AP*CP*CP*GP*TP*CP*C)-3'), DNA (5'-D(*AP*CP*TP*CP*TP*GP*CP*CP*TP*CP*AP*AP*GP*AP*CP*GP*GP*T)-3'), DNA (5'-D(*TP*TP*GP*AP*GP*GP*CP*AP*GP*AP*GP*T)-3'), ... | | Authors: | Tsutakawa, S.E, Classen, S, Chapados, B.R, Arvai, A, Finger, D.L, Guenther, G, Tomlinson, C.G, Thompson, P, Sarker, A.H, Shen, B, Cooper, P.K, Grasby, J.A, Tainer, J.A. | | Deposit date: | 2011-01-06 | | Release date: | 2011-04-27 | | Last modified: | 2023-09-13 | | Method: | X-RAY DIFFRACTION (2.319 Å) | | Cite: | Human Flap Endonuclease Structures, DNA Double-Base Flipping, and a Unified Understanding of the FEN1 Superfamily.
Cell(Cambridge,Mass.), 145, 2011
|
|
5K97
 | | Flap endonuclease 1 (FEN1) D233N with cleaved product fragment and Sm3+ | | Descriptor: | 1,2-ETHANEDIOL, DNA (5'-D(*AP*CP*CP*GP*TP*CP*C)-3'), DNA (5'-D(*AP*CP*TP*CP*TP*GP*CP*CP*TP*CP*AP*AP*GP*AP*CP*GP*GP*T)-3'), ... | | Authors: | Tsutakawa, S.E, Arvai, A.S, Tainer, J.A. | | Deposit date: | 2016-05-31 | | Release date: | 2017-06-28 | | Last modified: | 2024-02-28 | | Method: | X-RAY DIFFRACTION (2.102 Å) | | Cite: | Phosphate steering by Flap Endonuclease 1 promotes 5'-flap specificity and incision to prevent genome instability.
Nat Commun, 8, 2017
|
|
5KSE
 | | Flap endonuclease 1 (FEN1) R100A with 5'-flap substrate DNA and Sm3+ | | Descriptor: | DNA (5'-D(*AP*CP*CP*GP*TP*CP*C)-3'), DNA (5'-D(*AP*CP*TP*CP*TP*GP*CP*CP*TP*CP*AP*AP*GP*AP*CP*GP*GP*T)-3'), DNA (5'-D(P*TP*AP*AP*TP*TP*GP*AP*GP*GP*CP*AP*GP*AP*GP*T)-3'), ... | | Authors: | Tsutakawa, S.E, Arvai, A.S, Tainer, J.A. | | Deposit date: | 2016-07-08 | | Release date: | 2017-06-28 | | Last modified: | 2024-03-06 | | Method: | X-RAY DIFFRACTION (2.105 Å) | | Cite: | Phosphate steering by Flap Endonuclease 1 promotes 5'-flap specificity and incision to prevent genome instability.
Nat Commun, 8, 2017
|
|
5UM9
 | | Flap endonuclease 1 (FEN1) D86N with 5'-flap substrate DNA and Sm3+ | | Descriptor: | DNA (5'-D(*AP*CP*CP*GP*TP*CP*C)-3'), DNA (5'-D(*AP*CP*TP*CP*TP*GP*CP*CP*TP*CP*AP*AP*GP*AP*CP*GP*GP*T)-3'), DNA (5'-D(P*TP*CP*TP*TP*GP*AP*GP*GP*CP*AP*GP*AP*GP*T)-3'), ... | | Authors: | Tsutakawa, S.E, Arvai, A.S, Tainer, J.A. | | Deposit date: | 2017-01-26 | | Release date: | 2017-06-28 | | Last modified: | 2024-03-06 | | Method: | X-RAY DIFFRACTION (2.805 Å) | | Cite: | Phosphate steering by Flap Endonuclease 1 promotes 5'-flap specificity and incision to prevent genome instability.
Nat Commun, 8, 2017
|
|
1YMO
 | |
