4CAU
| THREE-DIMENSIONAL STRUCTURE OF DENGUE VIRUS SEROTYPE 1 COMPLEXED WITH 2 HMAB 14C10 FAB | Descriptor: | ENVELOPE PROTEIN E, FAB 14C10 | Authors: | Teoh, E.P, Kukkaro, P, Teo, E.W, Lim, A.P, Tan, T.T, Yip, A, Schul, W, Aung, M, Kostyuchenko, V.A, Leo, Y.S, Chan, S.H, Smith, K.G, Chan, A.H, Zou, G, Ooi, E.E, Kemeny, D.M, Tan, G.K, Ng, J.K, Ng, M.L, Alonso, S, Fisher, D, Shi, P.Y, Hanson, B.J, Lok, S.M, Macary, P.A. | Deposit date: | 2013-10-09 | Release date: | 2013-10-16 | Last modified: | 2017-08-23 | Method: | ELECTRON MICROSCOPY (7 Å) | Cite: | The Structural Basis for Serotype-Specific Neutralization of Dengue Virus by a Human Antibody. Sci.Trans.Med, 4, 2012
|
|
4ZCF
| Structural basis of asymmetric DNA methylation and ATP-triggered long-range diffusion by EcoP15I | Descriptor: | ADENOSINE MONOPHOSPHATE, CALCIUM ION, DNA 20-mer AATCATAGTCTACTGCTGTA, ... | Authors: | Gupta, Y.K, Chan, S.H, Xu, S.Y, Aggarwal, A.K. | Deposit date: | 2015-04-15 | Release date: | 2015-07-29 | Last modified: | 2024-03-06 | Method: | X-RAY DIFFRACTION (2.6 Å) | Cite: | Structural basis of asymmetric DNA methylation and ATP-triggered long-range diffusion by EcoP15I. Nat Commun, 6, 2015
|
|
2B5A
| C.BclI, Control Element of the BclI Restriction-Modification System | Descriptor: | ACETIC ACID, C.BclI | Authors: | Sawaya, M.R, Zhu, Z, Mersha, F, Chan, S.H, Dabur, R, Xu, S.Y, Balendiran, G.K. | Deposit date: | 2005-09-28 | Release date: | 2006-01-03 | Last modified: | 2024-02-14 | Method: | X-RAY DIFFRACTION (1.543 Å) | Cite: | Crystal Structure of the Restriction-Modification System Control Element C.BclI and Mapping of Its Binding Site. Structure, 13, 2005
|
|
3J05
| Three-dimensional structure of Dengue virus serotype 1 complexed with HMAb 14c10 Fab | Descriptor: | envelope protein | Authors: | Teoh, E.P, Kukkaro, P, Teo, E.W, Lim, A, Tan, T.T, Shi, P.Y, Yip, A, Schul, W, Leo, Y.S, Chan, S.H, Smith, K.G.C, Ooi, E.E, Kemeny, D.M, Ng, G, Ng, M.L, Alonso, S, Fisher, D, Hanson, B, Lok, S.M, MacAry, P.A. | Deposit date: | 2011-04-01 | Release date: | 2012-07-04 | Last modified: | 2024-02-21 | Method: | ELECTRON MICROSCOPY (7 Å) | Cite: | The structural basis for serotype-specific neutralization of dengue virus by a human antibody. Sci Transl Med, 4, 2012
|
|
6WKS
| Structure of SARS-CoV-2 nsp16/nsp10 in complex with RNA cap analogue (m7GpppA) and S-adenosylmethionine | Descriptor: | 1,2-ETHANEDIOL, 2'-O-methyltransferase, ADENOSINE, ... | Authors: | Gupta, Y.K, Viswanathan, T, Arya, S, Qi, S, Misra, A, Chan, S.-H. | Deposit date: | 2020-04-16 | Release date: | 2020-05-06 | Last modified: | 2023-10-18 | Method: | X-RAY DIFFRACTION (1.8 Å) | Cite: | Structural basis of RNA cap modification by SARS-CoV-2. Nat Commun, 11, 2020
|
|
3LDY
| An extraordinary mechanism of DNA perturbation exhibited by the rare-cutting HNH restriction endonuclease PacI | Descriptor: | CALCIUM ION, DNA (5'-D(*GP*AP*GP*GP*CP*TP*TP*A)-3'), DNA (5'-D(P*AP*TP*TP*AP*AP*GP*CP*CP*TP*C)-3'), ... | Authors: | Shen, B.W, Heiter, D, Chan, S.-H, Xu, S.-Y, Wilson, G, Stoddard, B.L. | Deposit date: | 2010-01-13 | Release date: | 2010-04-21 | Last modified: | 2024-02-21 | Method: | X-RAY DIFFRACTION (1.97 Å) | Cite: | Unusual target site disruption by the rare-cutting HNH restriction endonuclease PacI. Structure, 18, 2010
|
|
3S1S
| Characterization and crystal structure of the type IIG restriction endonuclease BpuSI | Descriptor: | 1,2-ETHANEDIOL, IODIDE ION, MANGANESE (II) ION, ... | Authors: | Shen, B.W, Xu, D, Chan, S.-H, Zheng, Y, Zhu, Y, Xu, S.-Y, Stoddard, B.L. | Deposit date: | 2011-05-16 | Release date: | 2011-07-13 | Last modified: | 2011-10-19 | Method: | X-RAY DIFFRACTION (2.35 Å) | Cite: | Characterization and crystal structure of the type IIG restriction endonuclease RM.BpuSI. Nucleic Acids Res., 39, 2011
|
|
3M7K
| Crystal structure of PacI-DNA Enzyme product complex | Descriptor: | 1,2-ETHANEDIOL, DNA (5'-D(*GP*AP*GP*GP*CP*TP*TP*AP*AP*T)-3'), DNA (5'-D(P*TP*AP*AP*GP*CP*CP*TP*C)-3'), ... | Authors: | Shen, B.W, Stoddard, B.L. | Deposit date: | 2010-03-16 | Release date: | 2010-04-21 | Last modified: | 2024-02-21 | Method: | X-RAY DIFFRACTION (1.92 Å) | Cite: | Unusual target site disruption by the rare-cutting HNH restriction endonuclease PacI. Structure, 18, 2010
|
|
3ODH
| Structure of OkrAI/DNA complex | Descriptor: | CALCIUM ION, DNA (5'-D(*TP*AP*TP*GP*GP*AP*TP*CP*CP*AP*TP*A)-3'), OkrAI endonuclease | Authors: | Vanamee, E.S, Aggarwal, A.K. | Deposit date: | 2010-08-11 | Release date: | 2010-10-06 | Last modified: | 2024-02-21 | Method: | X-RAY DIFFRACTION (2.3 Å) | Cite: | Asymmetric DNA recognition by the OkrAI endonuclease, an isoschizomer of BamHI. Nucleic Acids Res., 39, 2011
|
|
7LW3
| Structure of SARS-CoV-2 nsp16/nsp10 complex in presence of Cap-1 analog (m7GpppAmU) and SAH | Descriptor: | 1,2-ETHANEDIOL, 2'-O-methyltransferase, 2-(N-MORPHOLINO)-ETHANESULFONIC ACID, ... | Authors: | Gupta, Y.K, Viswanathan, T, Misra, A, Qi, S. | Deposit date: | 2021-02-27 | Release date: | 2021-05-05 | Last modified: | 2023-10-18 | Method: | X-RAY DIFFRACTION (2.3 Å) | Cite: | A metal ion orients SARS-CoV-2 mRNA to ensure accurate 2'-O methylation of its first nucleotide. Nat Commun, 12, 2021
|
|
7LW4
| Structure of SARS-CoV-2 nsp16/nsp10 complex in presence of S-adenosyl-L-homocysteine (SAH) | Descriptor: | 1,2-ETHANEDIOL, 2'-O-methyltransferase, 2-(N-MORPHOLINO)-ETHANESULFONIC ACID, ... | Authors: | Gupta, Y.K, Viswanathan, T, Misra, A, Qi, S. | Deposit date: | 2021-02-27 | Release date: | 2021-05-05 | Last modified: | 2023-10-18 | Method: | X-RAY DIFFRACTION (2.5 Å) | Cite: | A metal ion orients SARS-CoV-2 mRNA to ensure accurate 2'-O methylation of its first nucleotide. Nat Commun, 12, 2021
|
|
4L0K
| |
1W3E
| Ribosomal L30e of Thermococcus celer, P59A mutant | Descriptor: | 50S RIBOSOMAL PROTEIN L30E | Authors: | Ma, H.W, Lee, C.F, Allen, M.D, Bycroft, M, Wong, K.B. | Deposit date: | 2004-07-15 | Release date: | 2006-10-19 | Last modified: | 2023-12-13 | Method: | X-RAY DIFFRACTION (1.77 Å) | Cite: | Role of Proline Residues in Thermostability of T. Celer L30E Protein To be Published
|
|
1W41
| T. celer L30e E90A variant | Descriptor: | 50S RIBOSOMAL PROTEIN L30E | Authors: | Lee, C.F, Lee, K.M, Chan, S.H, Allen, M.D, Bycroft, M, Wong, K.B. | Deposit date: | 2004-07-22 | Release date: | 2005-04-08 | Last modified: | 2023-12-13 | Method: | X-RAY DIFFRACTION (1.7 Å) | Cite: | Electrostatic Interactions Contribute to Reduced Heat Capacity Change of Unfolding in a Thermophilic Ribosomal Protein L30E J.Mol.Biol., 348, 2005
|
|
1W40
| T. celer L30e K9A variant | Descriptor: | 50S RIBOSOMAL PROTEIN L30E | Authors: | Lee, C.F, Lee, K.M, Chan, S.H, Allen, M.D, Bycroft, M, Wong, K.B. | Deposit date: | 2004-07-22 | Release date: | 2005-04-08 | Last modified: | 2023-12-13 | Method: | X-RAY DIFFRACTION (2.03 Å) | Cite: | Electrostatic Interactions Contribute to Reduced Heat Capacity Change of Unfolding in a Thermophilic Ribosomal Protein L30E J.Mol.Biol., 348, 2005
|
|
1W42
| T. celer L30e R92A variant | Descriptor: | 50S RIBOSOMAL PROTEIN L30E | Authors: | Lee, C.F, Lee, K.M, Chan, S.H, Allen, M.D, Bycroft, M, Wong, K.B. | Deposit date: | 2004-07-22 | Release date: | 2005-04-08 | Last modified: | 2023-12-13 | Method: | X-RAY DIFFRACTION (1.8 Å) | Cite: | Electrostatic Interactions Contribute to Reduced Heat Capacity Change of Unfolding in a Thermophilic Ribosomal Protein L30E J.Mol.Biol., 348, 2005
|
|