Author results

1C04
  • Download 1c04
  • View 1c04
Molmil generated image of 1c04
IDENTIFICATION OF KNOWN PROTEIN AND RNA STRUCTURES IN A 5 A MAP OF THE LARGE RIBOSOMAL SUBUNIT FROM HALOARCULA MARISMORTUI
Descriptor:23S RRNA FRAGMENT, RIBOSOMAL PROTEIN L2, RIBOSOMAL PROTEIN L6, ...
Authors:Ban, N., Nissen, P., Capel, M., Moore, P.B., Steitz, T.A.
Deposit date:1999-07-14
Release date:1999-08-31
Last modified:2011-07-13
Method:X-RAY DIFFRACTION (5 Å)
Cite:Placement of protein and RNA structures into a 5 A-resolution map of the 50S ribosomal subunit.
Nature, 400, 1999
1FFZ
  • Download 1ffz
  • View 1ffz
Molmil generated image of 1ffz
LARGE RIBOSOMAL SUBUNIT COMPLEXED WITH R(CC)-DA-PUROMYCIN
Descriptor:23S RIBOSOMAL RNA, R(P*CP*C*)-D(P*A)-R(P*(PU))
Authors:Nissen, P., Hansen, J., Ban, N., Moore, P.B., Steitz, T.A.
Deposit date:2000-07-26
Release date:2000-08-28
Last modified:2011-07-13
Method:X-RAY DIFFRACTION (3.2 Å)
Cite:The structural basis of ribosome activity in peptide bond synthesis.
Science, 289, 2000
1FFK
  • Download 1ffk
  • View 1ffk
Molmil generated image of 1ffk
CRYSTAL STRUCTURE OF THE LARGE RIBOSOMAL SUBUNIT FROM HALOARCULA MARISMORTUI AT 2.4 ANGSTROM RESOLUTION
Descriptor:23S RRNA, 5S RRNA, RIBOSOMAL PROTEIN L2, ...
Authors:Ban, N., Nissen, P., Hansen, J., Moore, P.B., Steitz, T.A.
Deposit date:2000-07-25
Release date:2000-08-14
Last modified:2011-07-13
Method:X-RAY DIFFRACTION (2.4 Å)
Cite:The complete atomic structure of the large ribosomal subunit at 2.4 A resolution.
Science, 289, 2000
1FG0
  • Download 1fg0
  • View 1fg0
Molmil generated image of 1fg0
LARGE RIBOSOMAL SUBUNIT COMPLEXED WITH A 13 BP MINIHELIX-PUROMYCIN COMPOUND
Descriptor:23S RIBOSOMAL RNA, 5'-R(CCGGCGGGCUGGUUCAAACCGGCCCGCCGGACC)-3'-5'-R(P-PUROMYCIN)-3'
Authors:Nissen, P., Hansen, J., Ban, N., Moore, P.B., Steitz, T.A.
Deposit date:2000-07-26
Release date:2000-08-28
Last modified:2011-07-13
Method:X-RAY DIFFRACTION (3 Å)
Cite:The structural basis of ribosome activity in peptide bond synthesis.
Science, 289, 2000