Author results

  • Download 2xd0
  • View 2xd0
Molmil generated image of 2xd0
Descriptor:TOXN, TOXI
Authors:Blower, T.R., Pei, X.Y., Short, F.L., Fineran, P.C., Humphreys, D.P., Luisi, B.F., Salmond, G.P.C.
Deposit date:2010-04-28
Release date:2011-01-12
Last modified:2019-01-30
Cite:A processed noncoding RNA regulates an altruistic bacterial antiviral system.
Nat. Struct. Mol. Biol., 18, 2011
  • Download 2xdb
  • View 2xdb
Molmil generated image of 2xdb
Descriptor:TOXN, TOXI, SULFATE ION, ...
Authors:Blower, T.R., Pei, X.Y., Short, F.L., Fineran, P.C., Humphreys, D.P., Luisi, B.F., Salmond, G.P.C.
Deposit date:2010-04-30
Release date:2011-01-12
Last modified:2011-07-13
Cite:A Processed Noncoding RNA Regulates an Altruistic Bacterial Antiviral System.
Nat.Struct.Mol.Biol., 18, 2011
  • Download 5bs8
  • View 5bs8
Molmil generated image of 5bs8
Descriptor:DNA gyrase subunit A, DNA gyrase subunit B, DNA substrate 24-mer GGTCATGAATGACTATGCACGTAA, ...
Authors:Blower, T.R., Williamson, B.H., Kerns, R.J., Berger, J.M.
Deposit date:2015-06-01
Release date:2016-03-02
Method:X-RAY DIFFRACTION (2.399 Å)
Cite:Crystal structure and stability of gyrase-fluoroquinolone cleaved complexes from Mycobacterium tuberculosis.
Proc.Natl.Acad.Sci.USA, 113, 2016
  • Download 5bta
  • View 5bta
Molmil generated image of 5bta
Descriptor:DNA gyrase subunit A, DNA gyrase subunit B, DNA substrate 24-mer GGTCATGAATGACTATGCACGTAA, ...
Authors:Blower, T.R., Williamson, B.H., Kerns, R.J., Berger, J.M.
Deposit date:2015-06-02
Release date:2016-03-02
Last modified:2017-09-20
Cite:Crystal structure and stability of gyrase-fluoroquinolone cleaved complexes from Mycobacterium tuberculosis.
Proc.Natl.Acad.Sci.USA, 113, 2016
  • Download 5btc
  • View 5btc
Molmil generated image of 5btc
Descriptor:DNA gyrase subunit A, DNA gyrase subunit B, DNA substrate 24-mer GGTCATGAATGACTATGCACGTAA, ...
Authors:Blower, T.R., Williamson, B.H., Kerns, R.J., Berger, J.M.
Deposit date:2015-06-02
Release date:2016-03-02
Last modified:2017-09-20
Cite:Crystal structure and stability of gyrase-fluoroquinolone cleaved complexes from Mycobacterium tuberculosis.
Proc.Natl.Acad.Sci.USA, 113, 2016
  • Download 5btd
  • View 5btd
Molmil generated image of 5btd
Descriptor:DNA gyrase subunit A, DNA gyrase subunit B, DNA substrate 24-mer GGTCATGAATGACTATGCACGTAA, ...
Authors:Blower, T.R., Williamson, B.H., Kerns, R.J., Berger, J.M.
Deposit date:2015-06-03
Release date:2016-03-02
Last modified:2017-09-20
Method:X-RAY DIFFRACTION (2.497 Å)
Cite:Crystal structure and stability of gyrase-fluoroquinolone cleaved complexes from Mycobacterium tuberculosis.
Proc.Natl.Acad.Sci.USA, 113, 2016
  • Download 5btf
  • View 5btf
Molmil generated image of 5btf
Descriptor:DNA gyrase subunit A, DNA gyrase subunit B, DNA substrate 24-mer GGTCATGAATGACTATGCACGTAA, ...
Authors:Blower, T.R., Williamson, B.H., Kerns, R.J., Berger, J.M.
Deposit date:2015-06-03
Release date:2016-03-02
Last modified:2017-09-20
Cite:Crystal structure and stability of gyrase-fluoroquinolone cleaved complexes from Mycobacterium tuberculosis.
Proc.Natl.Acad.Sci.USA, 113, 2016
  • Download 5btg
  • View 5btg
Molmil generated image of 5btg
Descriptor:DNA gyrase subunit A, DNA gyrase subunit B, DNA substrate 24-mer GGTCATGAATGACTATGCACGTAA, ...
Authors:Blower, T.R., Williamson, B.H., Kerns, R.J., Berger, J.M.
Deposit date:2015-06-03
Release date:2016-03-02
Last modified:2017-09-20
Cite:Crystal structure and stability of gyrase-fluoroquinolone cleaved complexes from Mycobacterium tuberculosis.
Proc.Natl.Acad.Sci.USA, 113, 2016
  • Download 5bti
  • View 5bti
Molmil generated image of 5bti
Descriptor:DNA gyrase subunit A, DNA gyrase subunit B, DNA substrate 24-mer GGTCATGAATGACTATGCACGTAA, ...
Authors:Blower, T.R., Williamson, B.H., Kerns, R.J., Berger, J.M.
Deposit date:2015-06-03
Release date:2016-03-02
Last modified:2017-09-20
Method:X-RAY DIFFRACTION (2.501 Å)
Cite:Crystal structure and stability of gyrase-fluoroquinolone cleaved complexes from Mycobacterium tuberculosis.
Proc.Natl.Acad.Sci.USA, 113, 2016
  • Download 5btl
  • View 5btl
Molmil generated image of 5btl
Descriptor:DNA gyrase subunit A, DNA gyrase subunit B, DNA substrate 24-mer GGTCATGAATGACTATGCACGTAA, ...
Authors:Blower, T.R., Williamson, B.H., Kerns, R.J., Berger, J.M.
Deposit date:2015-06-03
Release date:2016-03-02
Last modified:2017-09-20
Cite:Crystal structure and stability of gyrase-fluoroquinolone cleaved complexes from Mycobacterium tuberculosis.
Proc.Natl.Acad.Sci.USA, 113, 2016
  • Download 5btn
  • View 5btn
Molmil generated image of 5btn
Descriptor:DNA gyrase subunit A, DNA gyrase subunit B, DNA substrate 24-mer GGTCATGAATGACTATGCACGTAA, ...
Authors:Blower, T.R., Williamson, B.H., Kerns, R.J., Berger, J.M.
Deposit date:2015-06-03
Release date:2016-03-02
Last modified:2017-09-20
Cite:Crystal structure and stability of gyrase-fluoroquinolone cleaved complexes from Mycobacterium tuberculosis.
Proc.Natl.Acad.Sci.USA, 113, 2016
  • Download 2xdd
  • View 2xdd
Molmil generated image of 2xdd
Authors:Blower, T.R., Pei, X.Y., Short, F.L., Fineran, P.C., Humphreys, D.P., Luisi, B.F., Salmond, G.P.C.
Deposit date:2010-04-30
Release date:2011-01-12
Last modified:2015-09-16
Cite:The Phage Abortive Infection System, Toxin, Functions as a Protein-RNA Toxin-Antitoxin Pair.
Proc.Natl.Acad.Sci.USA, 106, 2009
  • Download 4ato
  • View 4ato
Molmil generated image of 4ato
Authors:Short, F.L., Pei, X.Y., Blower, T.R., Ong, S.L., Luisi, B.F., Salmond, G.P.C.
Deposit date:2012-05-09
Release date:2012-12-26
Last modified:2013-01-30
Cite:Selectivity and Self-Assembly in the Control of a Bacterial Toxin by an Antitoxic Noncoding RNA Pseudoknot.
Proc.Natl.Acad.Sci.USA, 110, 2013
  • Download 4rmo
  • View 4rmo
Molmil generated image of 4rmo
Descriptor:CptN Toxin, RNA (45-MER), CALCIUM ION
Authors:Rao, F., Voss, J.E., Short, F.L., Luisi, B.F.
Deposit date:2014-10-21
Release date:2015-09-30
Last modified:2015-11-18
Cite:Co-evolution of quaternary organization and novel RNA tertiary interactions revealed in the crystal structure of a bacterial protein-RNA toxin-antitoxin system.
Nucleic Acids Res., 43, 2015