Author results

1D83
  • Download 1d83
  • View 1d83
Molmil generated image of 1d83
STRUCTURE REFINEMENT OF THE CHROMOMYCIN DIMER/DNA OLIGOMER COMPLEX IN SOLUTION
Descriptor:DNA (5'-D(*AP*AP*GP*GP*CP*CP*TP*T)-3'), 2,3-DIDEOXYFUCOSE, 4-O-ACETYL-2,6-DIDEOXY-3-C-METHYL-BETA-L-ARABINO-HEXOPYRANOSE, ...
Authors:Gao, X., Mirau, P., Patel, D.J.
Deposit date:1992-07-22
Release date:1993-07-15
Last modified:2011-07-13
Method:SOLUTION NMR
Cite:Structure refinement of the chromomycin dimer-DNA oligomer complex in solution.
J.Mol.Biol., 223, 1992
139D
  • Download 139d
  • View 139d
Molmil generated image of 139d
SOLUTION STRUCTURE OF A PARALLEL-STRANDED G-QUADRUPLEX DNA
Descriptor:DNA (5'-D(*TP*TP*GP*GP*GP*GP*T)-3')
Authors:Patel, D.J., Wang, Y.
Deposit date:1993-09-28
Release date:1994-01-31
Last modified:2011-07-13
Method:SOLUTION NMR
Cite:Solution structure of a parallel-stranded G-quadruplex DNA.
J.Mol.Biol., 234, 1993
134D
  • Download 134d
  • View 134d
Molmil generated image of 134d
SOLUTION STRUCTURE OF A PURINE(DOT)PURINE(DOT)PYRIMIDINE DNA TRIPLEX CONTAINING G(DOT)GC AND T(DOT)AT TRIPLES
Descriptor:DNA TRIPLEX
Authors:Patel, D.J., Radhakrishnan, I.
Deposit date:1993-08-30
Release date:1994-04-30
Last modified:2015-04-15
Method:SOLUTION NMR
Cite:Solution structure of a purine.purine.pyrimidine DNA triplex containing G.GC and T.AT triples.
Structure, 1, 1993
135D
  • Download 135d
  • View 135d
Molmil generated image of 135d
SOLUTION STRUCTURE OF A PURINE(DOT)PURINE(DOT)PYRIMIDINE DNA TRIPLEX CONTAINING G(DOT)GC AND T(DOT)AT TRIPLES
Descriptor:DNA TRIPLEX
Authors:Radhakrishnan, I., Patel, D.J.
Deposit date:1993-08-30
Release date:1994-04-30
Last modified:2011-07-13
Method:SOLUTION NMR
Cite:Solution structure of a purine.purine.pyrimidine DNA triplex containing G.GC and T.AT triples.
Structure, 1, 1993
136D
  • Download 136d
  • View 136d
Molmil generated image of 136d
SOLUTION STRUCTURE OF A PURINE(DOT)PURINE(DOT)PYRIMIDINE DNA TRIPLEX CONTAINING G(DOT)GC AND T(DOT)AT TRIPLES
Descriptor:DNA TRIPLEX
Authors:Radhakrishnan, I., Patel, D.J.
Deposit date:1993-08-30
Release date:1994-04-30
Last modified:2011-07-13
Method:SOLUTION NMR
Cite:Solution structure of a purine.purine.pyrimidine DNA triplex containing G.GC and T.AT triples.
Structure, 1, 1993
143D
  • Download 143d
  • View 143d
Molmil generated image of 143d
SOLUTION STRUCTURE OF THE HUMAN TELOMERIC REPEAT D(AG3[T2AG3]3) OF THE G-QUADRUPLEX
Descriptor:DNA (5'-D(*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*G)-3')
Authors:Wang, Y., Patel, D.J.
Deposit date:1993-10-08
Release date:1994-04-30
Last modified:2011-07-13
Method:SOLUTION NMR
Cite:Solution structure of the human telomeric repeat d[AG3(T2AG3)3] G-tetraplex.
Structure, 1, 1993
149D
  • Download 149d
  • View 149d
Molmil generated image of 149d
SOLUTION STRUCTURE OF A PYRIMIDINE(DOT)PURINE(DOT) PYRIMIDINE DNA TRIPLEX CONTAINING T(DOT)AT, C+(DOT)GC AND G(DOT)TA TRIPLES
Descriptor:5'-D(*CP*CP*TP*AP*TP*TP*C)-3', 5'-D(*GP*AP*AP*TP*AP*GP*G)-3', 5'-D(*CP*TP*TP*GP*TP*CP*C)-3'
Authors:Radhakrishnan, I., Patel, D.J.
Deposit date:1993-11-15
Release date:1994-04-30
Last modified:2011-07-13
Method:SOLUTION NMR
Cite:Solution structure of a pyrimidine.purine.pyrimidine DNA triplex containing T.AT, C+.GC and G.TA triples.
Structure, 2, 1994
179D
  • Download 179d
  • View 179d
Molmil generated image of 179d
SOLUTION STRUCTURE OF THE D(T-C-G-A) DUPLEX AT ACIDIC PH: A PARALLEL-STRANDED HELIX CONTAINING C+.C, G.G AND A.A PAIRS
Descriptor:DNA (5'-D(*TP*CP*GP*A)-3')
Authors:Wang, Y., Patel, D.J.
Deposit date:1994-06-15
Release date:1994-07-31
Last modified:2011-07-13
Method:SOLUTION NMR
Cite:Solution structure of the d(T-C-G-A) duplex at acidic pH. A parallel-stranded helix containing C+ .C, G.G and A.A pairs.
J.Mol.Biol., 242, 1994
177D
  • Download 177d
  • View 177d
Molmil generated image of 177d
SOLUTION STRUCTURE AND HYDRATION PATTERNS OF A PYRIMIDINE(DOT)PURINE(DOT)PYRIMIDINE DNA TRIPLEX CONTAINING A NOVEL T(DOT)CG TRIPLE
Descriptor:DNA (5'-D(*GP*AP*AP*CP*AP*GP*GP*TP*TP*TP*TP*T*CP*CP*TP*GP*TP*TP*CP*TP*TP*TP*TP*T*CP*TP*TP*TP*TP*CP*C)-3')
Authors:Radhakrishnan, I., Patel, D.J.
Deposit date:1994-05-24
Release date:1994-10-15
Last modified:2011-07-13
Method:SOLUTION NMR
Cite:Solution structure and hydration patterns of a pyrimidine.purine.pyrimidine DNA triplex containing a novel T.CG base-triple.
J.Mol.Biol., 241, 1994
186D
  • Download 186d
  • View 186d
Molmil generated image of 186d
SOLUTION STRUCTURE OF THE TETRAHYMENA TELOMERIC REPEAT D(T2G4)4 G-TETRAPLEX
Descriptor:DNA (5'-D(*TP*TP*GP*GP*GP*GP*TP*TP*GP*GP*GP*GP*TP*TP*GP*GP*GP*GP*TP*TP*GP*GP*GP*G)-3')
Authors:Wang, Y., Patel, D.J.
Deposit date:1994-08-22
Release date:1994-11-01
Last modified:2011-07-13
Method:SOLUTION NMR
Cite:Solution structure of the Tetrahymena telomeric repeat d(T2G4)4 G-tetraplex.
Structure, 2, 1994
199D
  • Download 199d
  • View 199d
Molmil generated image of 199d
SOLUTION STRUCTURE OF THE MONOALKYLATED MITOMYCIN C-DNA COMPLEX
Descriptor:DNA (5'-D(*(DI)P*CP*AP*CP*GP*TP*CP*(DI)P*T)-3'), DNA (5'-D(*AP*CP*GP*AP*CP*GP*TP*GP*C)-3'), CARBAMIC ACID 2,6-DIAMINO-5-METHYL-4,7-DIOXO-2,3,4,7-TETRAHYDRO-1H-3A-AZA-CYCLOPENTA[A]INDEN-8-YLMETHYL ESTER
Authors:Sastry, M., Fiala, R., Lipman, R., Tomasz, M., Patel, D.J.
Deposit date:1994-12-01
Release date:1995-02-07
Last modified:2011-07-13
Method:SOLUTION NMR
Cite:Solution structure of the monoalkylated mitomycin C-DNA complex.
J.Mol.Biol., 247, 1995
193D
  • Download 193d
  • View 193d
Molmil generated image of 193d
SOLUTION STRUCTURE OF A QUINOMYCIN BISINTERCALATOR-DNA COMPLEX
Descriptor:DNA (5'-D(*AP*CP*AP*CP*GP*TP*GP*T)-3'), QUINOMYCIN, 3-HYDROXYQUINALDIC ACID
Authors:Chen, H., Patel, D.J.
Deposit date:1994-09-30
Release date:1995-02-27
Last modified:2017-11-01
Method:SOLUTION NMR
Cite:Solution Structure of a Quinomycin Bisintercalator-DNA Complex.
J.Mol.Biol., 246, 1995
146D
  • Download 146d
  • View 146d
Molmil generated image of 146d
SOLUTION STRUCTURE OF THE MITHRAMYCIN DIMER-DNA COMPLEX
Descriptor:DNA (5'-D(*TP*CP*GP*CP*GP*A)-3'), 2,6-DIDEOXY-BETA-D-GLUCOSE, 2,6-DIDEOXY-BETA-D-GALACTOSE, ...
Authors:Sastry, M., Patel, D.J.
Deposit date:1993-11-09
Release date:1995-03-31
Last modified:2011-07-13
Method:SOLUTION NMR
Cite:Solution structure of the mithramycin dimer-DNA complex.
Biochemistry, 32, 1993
107D
  • Download 107d
  • View 107d
Molmil generated image of 107d
SOLUTION STRUCTURE OF THE COVALENT DUOCARMYCIN A-DNA DUPLEX COMPLEX
Descriptor:DNA (5'-D(*CP*CP*TP*TP*TP*TP*C)-3'), DNA (5'-D(*GP*AP*AP*AP*AP*GP*G)-3'), 4-HYDROXY-2,8-DIMETHYL-1-OXO-6-(4,5,6-TRIMETHOXY-1H-INDOLE-2-CARBONYL)-1,2,3,6,7,8-HEXAHYDRO-3,6-DIAZA-AS-INDACENE-2-CARBOXYLIC ACID METHYL ESTER
Authors:Lin, C.H., Patel, D.J.
Deposit date:1995-01-17
Release date:1995-05-08
Last modified:2011-07-13
Method:SOLUTION NMR
Cite:Solution structure of the covalent duocarmycin A-DNA duplex complex.
J.Mol.Biol., 248, 1995
202D
  • Download 202d
  • View 202d
Molmil generated image of 202d
SOLUTION STRUCTURE OF THE MENOGARIL-DNA COMPLEX
Descriptor:DNA (5'-D(*GP*AP*CP*AP*TP*GP*TP*C)-3'), MENOGARIL
Authors:Chen, H., Patel, D.J.
Deposit date:1995-03-29
Release date:1995-06-03
Last modified:2011-07-13
Method:SOLUTION NMR
Cite:Solution Structure of the Menogaril-DNA Complex
J.Am.Chem.Soc., 117, 1995
201D
  • Download 201d
  • View 201d
Molmil generated image of 201d
SOLUTION STRUCTURE OF THE OXYTRICHA TELOMERIC REPEAT D[G4(T4G4)3] G-TETRAPLEX
Descriptor:INTRAMOLECULAR G-TETRAPLEX DNA
Authors:Wang, Y., Patel, D.J.
Deposit date:1995-03-16
Release date:1995-07-31
Last modified:2011-07-13
Method:SOLUTION NMR
Cite:Solution structure of the Oxytricha telomeric repeat d[G4(T4G4)3] G-tetraplex.
J.Mol.Biol., 251, 1995
207D
  • Download 207d
  • View 207d
Molmil generated image of 207d
SOLUTION STRUCTURE OF MITHRAMYCIN DIMERS BOUND TO PARTIALLY OVERLAPPING SITES ON DNA
Descriptor:DNA (5'-D(*TP*AP*GP*CP*TP*AP*GP*CP*TP*A)-3'), 2,6-DIDEOXY-BETA-D-GLUCOSE, 2,6-DIDEOXY-BETA-D-GALACTOSE, ...
Authors:Sastry, M., Fiala, R., Patel, D.J.
Deposit date:1995-04-20
Release date:1995-09-15
Last modified:2011-07-13
Method:SOLUTION NMR
Cite:Solution structure of mithramycin dimers bound to partially overlapping sites on DNA.
J.Mol.Biol., 251, 1995
1FJA
  • Download 1fja
  • View 1fja
Molmil generated image of 1fja
NMR STUDY OF DEOXYRIBONUCLEIC ACID COMPLEXED WITH ACTINOMYCIN D
Descriptor:DNA (5'-D(*AP*AP*GP*CP*GP*CP*TP*T)-3'), ACTINOMYCIN D
Authors:Chen, H., Liu, X., Patel, D.J.
Deposit date:1995-12-15
Release date:1996-06-10
Last modified:2012-12-12
Method:SOLUTION NMR
Cite:DNA Bending and Unwinding Associated with Actinomycin D Antibiotics Bound to Partially Overlapping Sites on DNA.
J.Mol.Biol., 258, 1996
1FJB
  • Download 1fjb
  • View 1fjb
Molmil generated image of 1fjb
NMR STUDY OF AN 11-MER DNA DUPLEX CONTAINING 7,8-DIHYDRO-8-OXOADENINE (AOXO) OPPOSITE THYMINE
Descriptor:DNA (5'-D(*GP*CP*AP*TP*GP*TP*GP*TP*AP*CP*G)-3'), DNA (5'-D(*CP*GP*TP*AP*CP*(A38)P*CP*AP*TP*GP*C)-3')
Authors:Chen, H., Johnson, F., Grollman, A.P., Patel, D.J.
Deposit date:1995-12-15
Release date:1996-06-10
Last modified:2011-07-13
Method:SOLUTION NMR
Cite:Structural Studies of the Ionizing Radiation Adduct 7,8-Dihydro-8-Oxoadenine (A Oxo) Positioned Opposite Thymine and Guanine in DNA Duplexes
MAGN.RESON.CHEM., 34, 1996
1FMN
  • Download 1fmn
  • View 1fmn
Molmil generated image of 1fmn
SOLUTION STRUCTURE OF FMN-RNA APTAMER COMPLEX, NMR, 5 STRUCTURES
Descriptor:RNA (5'-R(*GP*GP*CP*GP*UP*GP*UP*AP*GP*GP *AP*UP*AP*UP*GP*CP*UP*UP*CP*GP*GP*CP*AP*GP*AP*AP*GP *GP*AP*CP*AP*CP*GP*CP*C)-3'), FLAVIN MONONUCLEOTIDE
Authors:Fan, P., Suri, A.K., Fiala, R., Live, D., Patel, D.J.
Deposit date:1995-12-04
Release date:1996-07-11
Last modified:2011-07-13
Method:SOLUTION NMR
Cite:Molecular recognition in the FMN-RNA aptamer complex.
J.Mol.Biol., 258, 1996
1SLO
  • Download 1slo
  • View 1slo
Molmil generated image of 1slo
FIRST STEM LOOP OF THE SL1 RNA FROM CAENORHABDITIS ELEGANS, NMR, MINIMIZED AVERAGE STRUCTURE
Descriptor:RNA (5'-R(*UP*UP*AP*CP*CP*CP*AP*AP*GP*UP*UP*UP*GP*AP*GP*GP*UP*AP*A)-3')
Authors:Greenbaum, N.L., Radhakrishnan, I., Patel, D.J., Hirsh, D.
Deposit date:1996-05-24
Release date:1996-12-07
Last modified:2011-07-13
Method:SOLUTION NMR
Cite:Solution structure of the donor site of a trans-splicing RNA.
Structure, 4, 1996
1BIV
  • Download 1biv
  • View 1biv
Molmil generated image of 1biv
BOVINE IMMUNODEFICIENCY VIRUS TAT-TAR COMPLEX, NMR, 5 STRUCTURES
Descriptor:BOVINE IMMUNODEFICIENCY VIRUS TAR RNA, BOVINE IMMUNODEFICIENCY VIRUS TAT PEPTIDE
Authors:Ye, X., Kumar, R.A., Patel, D.J.
Deposit date:1996-06-12
Release date:1996-12-23
Last modified:2016-05-25
Method:SOLUTION NMR
Cite:Molecular recognition in the bovine immunodeficiency virus Tat peptide-TAR RNA complex.
Chem.Biol., 2, 1995
1PIK
  • Download 1pik
  • View 1pik
Molmil generated image of 1pik
ESPERAMICIN A1-DNA COMPLEX, NMR, 4 STRUCTURES
Descriptor:DNA (5'-D(C*GP*GP*AP*TP*CP*CP*GP)-3'), 2,4-DIDEOXY-4-[2-(PROPYL)AMINO]-3-O-METHYL ALPHA-L-THREO-PENTOPYRANOSIDE, 4,5-DIMETHOXY-N-(2'-METHOXYPROPENOYL ANTHRANILATE), ...
Authors:Kumar, R.A., Ikemoto, N., Patel, D.J.
Deposit date:1996-12-11
Release date:1997-03-12
Last modified:2011-07-13
Method:SOLUTION NMR
Cite:Solution Structure of the Esperamicin A1-DNA Complex
J.Mol.Biol., 265, 1997
1OLD
  • Download 1old
  • View 1old
Molmil generated image of 1old
NMR STRUCTURE OF 24-MER DEOXYRIBONUCLEIC ACID, 7 STRUCTURES
Descriptor:DNA (GATCGAAACGTAGCGCCTTCGATC), DEOXY-METHYL-ARGININE
Authors:Lin, C.H., Patel, D.J.
Deposit date:1996-10-31
Release date:1997-04-21
Last modified:2011-07-13
Method:SOLUTION NMR
Cite:Encapsulating an amino acid in a DNA fold.
Nat.Struct.Biol., 3, 1996
1SLP
  • Download 1slp
  • View 1slp
Molmil generated image of 1slp
FIRST STEM LOOP OF THE SL1 RNA FROM CAENORHABDITIS ELEGANS, NMR, 16 STRUCTURES
Descriptor:RNA (5'-R(*UP*UP*AP*CP*CP*CP*AP*AP*GP*UP*UP*UP*GP*AP*GP*GP*UP*AP*A)-3')
Authors:Greenbaum, N.L., Radhakrishnan, I., Patel, D.J., Hirsh, D.
Deposit date:1996-05-24
Release date:1997-04-21
Last modified:2011-07-13
Method:SOLUTION NMR
Cite:Solution structure of the donor site of a trans-splicing RNA.
Structure, 4, 1996