Author results

1AFX
  • Download 1afx
  • View 1afx
Molmil generated image of 1afx
UGAA EUKARYOTIC RIBOSOMAL RNA TETRALOOP, NMR, 13 STRUCTURES
Descriptor:RNA (5'-R(*GP*GP*UP*GP*UP*GP*AP*AP*CP*AP*CP*C)-3')
Authors:Butcher, S.E., Dieckmann, T., Feigon, J.
Deposit date:1997-03-15
Release date:1997-05-15
Last modified:2011-07-13
Method:SOLUTION NMR
Cite:Solution structure of the loop B domain from the hairpin ribozyme.
Nat.Struct.Biol., 6, 1999
1B36
  • Download 1b36
  • View 1b36
Molmil generated image of 1b36
SOLUTION STRUCTURE OF THE HAIRPIN RIBOZYME LOOP B DOMAIN RNA, NMR, 10 STRUCTURES
Descriptor:RNA (RNA LOOP B)
Authors:Butcher, S.E., Dieckmann, T., Feigon, J.
Deposit date:1998-12-17
Release date:1998-12-23
Last modified:2011-07-13
Method:SOLUTION NMR
Cite:Solution structure of the loop B domain from the hairpin ribozyme.
Nat.Struct.Biol., 6, 1999
1TLR
  • Download 1tlr
  • View 1tlr
Molmil generated image of 1tlr
SOLUTION STRUCTURE OF TETRALOOP RECEPTOR RNA, NMR, 20 STRUCTURES
Descriptor:RNA TETRALOOP RECEPTOR (5'-R(GGCCUAAGACUUCGGUUAUGGCC)-3')
Authors:Butcher, S.E., Dieckmann, T., Feigon, J.
Deposit date:1997-09-11
Release date:1997-11-12
Last modified:2011-07-13
Method:SOLUTION NMR
Cite:Solution structure of a GAAA tetraloop receptor RNA.
EMBO J., 16, 1997
2KEZ
  • Download 2kez
  • View 2kez
Molmil generated image of 2kez
NMR STRUCTURE OF U6 ISL AT PH 8.0
Descriptor:RNA (5'-R(*GP*GP*UP*UP*CP*CP*CP*CP*UP*GP*CP*AP*UP*AP*AP*GP*GP*AP*UP*GP*AP*AP*CP*C)-3')
Authors:Venditti, V., Butcher, S.E.
Deposit date:2009-02-08
Release date:2009-07-21
Last modified:2011-07-13
Method:SOLUTION NMR
Cite:Minimum-energy path for a u6 RNA conformational change involving protonation, base-pair rearrangement and base flipping.
J.Mol.Biol., 391, 2009
2KF0
  • Download 2kf0
  • View 2kf0
Molmil generated image of 2kf0
NMR STRUCTURE OF U6 ISL AT PH 7.0
Descriptor:RNA (5'-R(*GP*GP*UP*UP*CP*CP*CP*CP*UP*GP*CP*AP*UP*AP*AP*GP*GP*AP*UP*GP*AP*AP*CP*C)-3')
Authors:Venditti, V., Butcher, S.E.
Deposit date:2009-02-08
Release date:2009-07-21
Last modified:2011-07-13
Method:SOLUTION NMR
Cite:Minimum-energy path for a u6 RNA conformational change involving protonation, base-pair rearrangement and base flipping.
J.Mol.Biol., 391, 2009
1SY4
  • Download 1sy4
  • View 1sy4
Molmil generated image of 1sy4
REFINED SOLUTION STRUCTURE OF THE S. CEREVISIAE U6 INTRAMOLECULAR STEM LOOP (ISL) RNA USING RESIDUAL DIPOLAR COUPLINGS (RDCS)
Descriptor:U6 Intramolecular Stem-Loop RNA
Authors:Reiter, N.J., Nikstad, L.J., Allman, A.M., Johnson, R.J., Butcher, S.E.
Deposit date:2004-03-31
Release date:2004-04-06
Last modified:2011-07-13
Method:SOLUTION NMR
Cite:Structure of the U6 RNA intramolecular stem-loop harboring an S(P)-phosphorothioate modification.
RNA, 9, 2003
1SYZ
  • Download 1syz
  • View 1syz
Molmil generated image of 1syz
SOLUTION STRUCTURE OF THE S. CEREVISIAE U6 INTRAMOLECULAR STEM LOOP (ISL) RNA AT PH 5.7
Descriptor:U6 INTRAMOLECULAR STEM-LOOP RNA
Authors:Reiter, N.J., Blad, H., Abildgaard, F., Butcher, S.E.
Deposit date:2004-04-02
Release date:2004-11-09
Last modified:2011-07-13
Method:SOLUTION NMR
Cite:Dynamics in the U6 RNA Intramolecular Stem-Loop: A Base Flipping Conformational Change.
Biochemistry, 43, 2004
5UQJ
  • Download 5uqj
  • View 5uqj
Molmil generated image of 5uqj
STRUCTURE OF YEAST USB1
Descriptor:U6 snRNA phosphodiesterase, SULFATE ION, GLYCEROL, ...
Authors:Didychuk, A.L., Montemayor, E.J., Butcher, S.E.
Deposit date:2017-02-08
Release date:2017-08-16
Last modified:2019-02-27
Method:X-RAY DIFFRACTION (1.8 Å)
Cite:Usb1 controls U6 snRNP assembly through evolutionarily divergent cyclic phosphodiesterase activities.
Nat Commun, 8, 2017
5V1M
  • Download 5v1m
  • View 5v1m
Molmil generated image of 5v1m
STRUCTURE OF HUMAN USB1 WITH URIDINE 5'-MONOPHOSPHATE
Descriptor:U6 snRNA phosphodiesterase, CHLORIDE ION, GLYCEROL, ...
Authors:Montemayor, E.J., Didychuk, A.L., Butcher, S.E.
Deposit date:2017-03-02
Release date:2017-08-16
Last modified:2019-02-27
Method:X-RAY DIFFRACTION (1.47 Å)
Cite:Usb1 controls U6 snRNP assembly through evolutionarily divergent cyclic phosphodiesterase activities.
Nat Commun, 8, 2017
1K4A
  • Download 1k4a
  • View 1k4a
Molmil generated image of 1k4a
STRUCTURE OF AGAA RNA TETRALOOP, NMR, 20 STRUCTURES
Descriptor:5'-R(*GP*GP*UP*UP*CP*AP*GP*AP*AP*GP*AP*AP*CP*C)-3'
Authors:Wu, H., Yang, P.K., Butcher, S.E., Kang, S., Chanfreau, G., Feigon, J.
Deposit date:2001-10-07
Release date:2001-12-19
Last modified:2011-07-13
Method:SOLUTION NMR
Cite:A novel family of RNA tetraloop structure forms the recognition site for Saccharomyces cerevisiae RNase III.
EMBO J., 20, 2001
1K4B
  • Download 1k4b
  • View 1k4b
Molmil generated image of 1k4b
STRUCTURE OF AGUU RNA TETRALOOP, NMR, 20 STRUCTURES
Descriptor:5'-R(*GP*GP*UP*UP*CP*AP*GP*UP*UP*GP*AP*AP*CP*C)-3'
Authors:Wu, H., Yang, P.K., Butcher, S.E., Kang, S., Chanfreau, G., Feigon, J.
Deposit date:2001-10-07
Release date:2001-12-19
Last modified:2011-07-13
Method:SOLUTION NMR
Cite:A novel family of RNA tetraloop structure forms the recognition site for Saccharomyces cerevisiae RNase III.
EMBO J., 20, 2001
1LC6
  • Download 1lc6
  • View 1lc6
Molmil generated image of 1lc6
SOLUTION STRUCTURE OF THE U6 INTRAMOLECULAR STEM-LOOP RNA
Descriptor:U6 Intramolecular Stem-loop RNA
Authors:Huppler, A., Nikstad, L.J., Allmann, A.M., Brow, D.A., Butcher, S.E.
Deposit date:2002-04-05
Release date:2002-05-29
Last modified:2011-07-13
Method:SOLUTION NMR
Cite:Metal binding and base ionization in the U6 RNA intramolecular stem-loop structure.
Nat.Struct.Biol., 9, 2002
1NC0
  • Download 1nc0
  • View 1nc0
Molmil generated image of 1nc0
U80G U6 INTRAMOLECULAR STEM-LOOP RNA FROM SACCHAROMYCES CEREVISIAE
Descriptor:U80G U6 RNA Intramolecular Stem-Loop
Authors:Sashital, D.G., Allmann, A.M., Van Doren, S., Butcher, S.E.
Deposit date:2002-12-04
Release date:2003-02-25
Last modified:2011-07-13
Method:SOLUTION NMR
Cite:Structural Basis for a Lethal Mutation in U6 RNA
Biochemistry, 42, 2003
1NZ1
  • Download 1nz1
  • View 1nz1
Molmil generated image of 1nz1
SOLUTION STRUCTURE OF THE S. CEREVISIAE U6 INTRAMOLECULAR STEM-LOOP CONTAINING AN SP PHOSPHOROTHIOATE AT NUCLEOTIDE U80
Descriptor:SP U6 Intramolecular Stem-Loop RNA
Authors:Reiter, N.J., Nikstad, L.J., Allman, A.M., Johnson, R.J., Butcher, S.E.
Deposit date:2003-02-14
Release date:2003-05-13
Last modified:2011-07-13
Method:SOLUTION NMR
Cite:Structure of the U6 RNA intramolecular stem-loop harboring an S(P)-phosphorothioate modification.
RNA, 9, 2003
1PJY
  • Download 1pjy
  • View 1pjy
Molmil generated image of 1pjy
SOLUTION STRUCTURE OF THE HIV-1 FRAMESHIFT INDUCING STEM-LOOP RNA
Descriptor:HIV-1 frameshift inducing stem-loop
Authors:Staple, D.W., Butcher, S.E.
Deposit date:2003-06-04
Release date:2003-08-05
Last modified:2011-07-13
Method:SOLUTION NMR
Cite:Solution structure of the HIV-1 frameshift inducing stem-loop RNA.
Nucleic Acids Res., 31, 2003
1R2P
  • Download 1r2p
  • View 1r2p
Molmil generated image of 1r2p
SOLUTION STRUCTURE OF DOMAIN 5 FROM THE AI5(GAMMA) GROUP II INTRON
Descriptor:34-MER
Authors:Sigel, R.K.O., Sashital, D.G., Abramovitz, D.L., Palmer III, A.G., Butcher, S.E., Pyle, A.M.
Deposit date:2003-09-29
Release date:2004-02-03
Last modified:2011-07-13
Method:SOLUTION NMR
Cite:Solution structure of domain 5 of a group II intron ribozyme reveals a new RNA motif.
Nat.Struct.Mol.Biol., 11, 2004
1XHP
  • Download 1xhp
  • View 1xhp
Molmil generated image of 1xhp
SOLUTION STRUCTURE OF THE EXTENDED U6 ISL AS OBSERVED IN THE U2/U6 COMPLEX FROM SACCHAROMYCES CEREVISIAE
Descriptor:U6 snRNA
Authors:Sashital, D.G., Cornilescu, G., Butcher, S.E.
Deposit date:2004-09-20
Release date:2004-11-23
Last modified:2011-07-13
Method:SOLUTION NMR
Cite:U2-U6 RNA folding reveals a group II intron-like domain and a four-helix junction
Nat.Struct.Mol.Biol., 11, 2004
1Z2J
  • Download 1z2j
  • View 1z2j
Molmil generated image of 1z2j
SOLUTION STRUCTURE OF THE HIV-1 FRAMESHIFT INDUCING ELEMENT
Descriptor:HIV-1 frameshift site RNA
Authors:Staple, D.W., Butcher, S.E.
Deposit date:2005-03-08
Release date:2005-06-14
Last modified:2011-07-13
Method:SOLUTION NMR
Cite:Solution Structure and Thermodynamic Investigation of the HIV-1 Frameshift Inducing Element.
J.Mol.Biol., 349, 2005
2ADT
  • Download 2adt
  • View 2adt
Molmil generated image of 2adt
NMR STRUCTURE OF A 30 KDA GAAA TETRALOOP-RECEPTOR COMPLEX.
Descriptor:43-MER
Authors:Davis, J.H., Tonelli, M., Scott, L.G., Jaeger, L., Williamson, J.R., Butcher, S.E.
Deposit date:2005-07-20
Release date:2005-07-26
Last modified:2011-07-13
Method:SOLUTION NMR
Cite:RNA Helical Packing in Solution: NMR Structure of a 30 kDa GAAA Tetraloop-Receptor Complex
J.Mol.Biol., 351, 2005
2GO9
  • Download 2go9
  • View 2go9
Molmil generated image of 2go9
RRM DOMAINS 1 AND 2 OF PRP24 FROM S. CEREVISIAE
Descriptor:U4/U6 snRNA-associated splicing factor PRP24
Authors:Reiter, N.J., Lee, D.H., Tonelli, M., Kwan, S.K., Brow, D.A., Butcher, S.E.
Deposit date:2006-04-12
Release date:2007-02-27
Last modified:2011-07-13
Method:SOLUTION NMR
Cite:Structure and interactions of the first three RNA recognition motifs of splicing factor prp24.
J.Mol.Biol., 367, 2007
2I7E
  • Download 2i7e
  • View 2i7e
Molmil generated image of 2i7e
GAAA TETRALOOOP RECEPTOR COMPLEX WITH ASSOCIATED COBALT HEXAMMINE.
Descriptor:43-MER, COBALT HEXAMMINE(III)
Authors:Davis, J.H., Butcher, S.E.
Deposit date:2006-08-30
Release date:2007-04-03
Last modified:2011-07-13
Method:SOLUTION NMR
Cite:Role of metal ions in the tetraloop-receptor complex as analyzed by NMR.
Rna, 13, 2007
2I7Z
  • Download 2i7z
  • View 2i7z
Molmil generated image of 2i7z
GAAA TETRALOOP RECEPTOR COMPLEX WITH ASSOCIATED MANGANESE IONS.
Descriptor:43-MER, MANGANESE (II) ION
Authors:Davis, J.H., Butcher, S.E.
Deposit date:2006-08-31
Release date:2007-04-03
Last modified:2011-12-28
Method:SOLUTION NMR
Cite:Role of metal ions in the tetraloop-receptor complex as analyzed by NMR.
Rna, 13, 2007
2JTP
  • Download 2jtp
  • View 2jtp
Molmil generated image of 2jtp
SOLUTION STRUCTURE OF THE FRAMESHIFT-INDUCING RNA STEM-LOOP IN SIV
Descriptor:SIV17-50 RNA (34-MER)
Authors:Marcheschi, R.J., Staple, D.W., Butcher, S.E.
Deposit date:2007-08-04
Release date:2007-10-02
Last modified:2011-07-13
Method:SOLUTION NMR
Cite:Programmed Ribosomal Frameshifting in SIV Is Induced by a Highly Structured RNA Stem-Loop
J.Mol.Biol., 373, 2007
2JUK
  • Download 2juk
  • View 2juk
Molmil generated image of 2juk
GUANIDINO NEOMYCIN B RECOGNITION OF AN HIV-1 RNA HELIX
Descriptor:HIV-1 frameshift site RNA, (1S,2R,3S,4R,6S)-4,6-bis{[amino(iminio)methyl]amino}-2-{[3-O-(2,6-bis{[amino(iminio)methyl]amino}-2,6-dideoxy-beta-L-glucopyranosyl)-beta-D-arabinofuranosyl]oxy}-3-hydroxycyclohexyl 2,6-bis{[amino(iminio)methyl]amino}-2,6-dideoxy-beta-L-glucopyranoside
Authors:Staple, D.W., Venditti, V., Niccolai, N., Elson-Schwab, L., Tor, Y., Butcher, S.E.
Deposit date:2007-08-30
Release date:2007-11-20
Last modified:2011-07-13
Method:SOLUTION NMR
Cite:Guanidinoneomycin B Recognition of an HIV-1 RNA Helix.
Chembiochem, 9, 2008
2JWV
  • Download 2jwv
  • View 2jwv
Molmil generated image of 2jwv
STRUCTURE OF A HIGH AFFINITY ANTI-NFKB RNA APTAMER
Descriptor:RNA (29-MER)
Authors:Reiter, N.J., Maher III, L., Butcher, S.E.
Deposit date:2007-10-25
Release date:2008-01-08
Last modified:2011-07-13
Method:SOLUTION NMR
Cite:DNA mimicry by a high-affinity anti-NF-kappaB RNA aptamer
Nucleic Acids Res., 36, 2008
<12>