6W4L
| The crystal structure of a single chain H2B-H2A histone chimera from Xenopus laevis | Descriptor: | Histone H2B 1.1,Histone H2A type 1, PYROPHOSPHATE | Authors: | Warren, C, Bonanno, J.B, Almo, S.C, Shechter, D. | Deposit date: | 2020-03-11 | Release date: | 2020-05-06 | Last modified: | 2023-10-18 | Method: | X-RAY DIFFRACTION (1.31 Å) | Cite: | Structure of a single-chain H2A/H2B dimer. Acta Crystallogr.,Sect.F, 76, 2020
|
|
8QU4
| NF-YB/C Heterodimer in Complex with a 13-mer NF-YA-derived Peptide Stabilized with C8-Hydrocarbon Linker in an alternative binding pose | Descriptor: | 1,2-ETHANEDIOL, 2-AMINO-2-HYDROXYMETHYL-PROPANE-1,3-DIOL, Nuclear transcription factor Y subunit alpha, ... | Authors: | Arbore, F, Durukan, C, Klintrot, C.I.R, Grossmann, T.N, Hennig, S. | Deposit date: | 2023-10-13 | Release date: | 2024-03-20 | Method: | X-RAY DIFFRACTION (1.38 Å) | Cite: | Binding dynamics of a stapled peptide targeting the transcription factor NF-Y. Chembiochem, 2024
|
|
8QU3
| NF-YB/C Heterodimer in Complex with a 13-mer NF-YA-derived Peptide Stabilized with C8-Hydrocarbon Linker | Descriptor: | 2-AMINO-2-HYDROXYMETHYL-PROPANE-1,3-DIOL, FORMIC ACID, Nuclear transcription factor Y subunit alpha, ... | Authors: | Arbore, F, Durukan, C, Klintrot, C.I.R, Grossmann, T.N, Hennig, S. | Deposit date: | 2023-10-13 | Release date: | 2024-03-20 | Method: | X-RAY DIFFRACTION (1.41 Å) | Cite: | Binding dynamics of a stapled peptide targeting the transcription factor NF-Y. Chembiochem, 2024
|
|
8QU2
| NF-YB/C Heterodimer in Complex with a 16-mer NF-YA-derived Peptide Stabilized with C8-Hydrocarbon Linker | Descriptor: | 1,2-ETHANEDIOL, 2-AMINO-2-HYDROXYMETHYL-PROPANE-1,3-DIOL, FORMIC ACID, ... | Authors: | Durukan, C, Arbore, F, Klintrot, C.I.R, Grossmann, T.N, Hennig, S. | Deposit date: | 2023-10-13 | Release date: | 2024-03-20 | Method: | X-RAY DIFFRACTION (1.45 Å) | Cite: | Binding dynamics of a stapled peptide targeting the transcription factor NF-Y. Chembiochem, 2024
|
|
4CAY
| Crystal structure of a human Anp32e-H2A.Z-H2B complex | Descriptor: | ACIDIC LEUCINE-RICH NUCLEAR PHOSPHOPROTEIN 32 FAMILY MEMBER E, HISTONE H2A.Z, HISTONE H2B TYPE 1-J | Authors: | Obri, A, Ouararhni, K, Papin, C, Diebold, M.-L, Padmanabhan, K, Marek, M, Stoll, I, Roy, L, Reilly, P.T, Mak, T.W, Dimitrov, S, Romier, C, Hamiche, A. | Deposit date: | 2013-10-09 | Release date: | 2014-01-22 | Last modified: | 2023-12-20 | Method: | X-RAY DIFFRACTION (1.48 Å) | Cite: | Anp32E is a Histone Chaperone that Removes H2A.Z from Chromatin Nature, 648, 2014
|
|
4CSR
| High resolution crystal structure of the histone fold dimer (NF-YB)-(NF-YC) | Descriptor: | GLYCEROL, NUCLEAR TRANSCRIPTION FACTOR Y SUBUNIT BETA, NUCLEAR TRANSCRIPTION FACTOR Y SUBUNIT GAMMA | Authors: | Gnesutta, N, Cocolo, S, Mantovani, R, Bolognesi, M, Nardini, M. | Deposit date: | 2014-03-09 | Release date: | 2015-03-18 | Last modified: | 2023-12-20 | Method: | X-RAY DIFFRACTION (1.5 Å) | Cite: | High Resolution Crystal Structure of the Histone Fold Dimer (NF-Yb)-(NF-Yc) To be Published
|
|
7BP6
| |
7BP2
| |
6AE8
| Structure insight into histone chaperone Chz1-mediated H2A.Z recognition and replacement | Descriptor: | BICINE, Histone H2A.Z-specific chaperone CHZ1, Histone H2B.1,Histone H2A.Z | Authors: | Wang, Y.Y, Shan, S, Zhou, Z. | Deposit date: | 2018-08-03 | Release date: | 2019-04-17 | Last modified: | 2023-11-22 | Method: | X-RAY DIFFRACTION (1.65 Å) | Cite: | Structural insights into histone chaperone Chz1-mediated H2A.Z recognition and histone replacement. Plos Biol., 17, 2019
|
|
1N1J
| Crystal structure of the NF-YB/NF-YC histone pair | Descriptor: | NF-YB, NF-YC | Authors: | Romier, C, Cocchiarella, F, Mantovani, R, Moras, D. | Deposit date: | 2002-10-18 | Release date: | 2003-02-18 | Last modified: | 2024-03-13 | Method: | X-RAY DIFFRACTION (1.67 Å) | Cite: | The NF-YB/NF-YC structure gives insight into DNA binding and transcription regulation by CCAAT factor NF-Y J.Biol.Chem., 278, 2003
|
|
2HUE
| Structure of the H3-H4 chaperone Asf1 bound to histones H3 and H4 | Descriptor: | Anti-silencing protein 1, GLYCEROL, Histone H3, ... | Authors: | English, C.M, Churchill, M.E.A, Tyler, J.K. | Deposit date: | 2006-07-26 | Release date: | 2006-11-21 | Last modified: | 2024-02-14 | Method: | X-RAY DIFFRACTION (1.7 Å) | Cite: | Structural basis for the histone chaperone activity of asf1. Cell(Cambridge,Mass.), 127, 2006
|
|
4M6B
| Crystal structure of yeast Swr1-Z domain in complex with H2A.Z-H2B dimer | Descriptor: | Chimera protein of Histone H2B.1 and Histone H2A.Z, Helicase SWR1 | Authors: | Hong, J.J, Feng, H.Q, Wang, F, Ranjan, A, Chen, J.H, Jiang, J.S, Girlando, R, Xiao, T.S, Wu, C, Bai, Y.W. | Deposit date: | 2013-08-09 | Release date: | 2014-02-19 | Last modified: | 2024-02-28 | Method: | X-RAY DIFFRACTION (1.78 Å) | Cite: | The Catalytic Subunit of the SWR1 Remodeler Is a Histone Chaperone for the H2A.Z-H2B Dimer. Mol.Cell, 53, 2014
|
|
6QMS
| NF-YB/C Heterodimer in Complex with NF-YA-derived Peptide Stabilized with C11-Hydrocarbon Linker | Descriptor: | Nuclear transcription factor Y subunit alpha, Nuclear transcription factor Y subunit beta, Nuclear transcription factor Y subunit gamma | Authors: | Kiehstaller, S, Jeganathan, S, Pearce, N.M, Wendt, M, Grossmann, T.N, Hennig, S. | Deposit date: | 2019-02-08 | Release date: | 2019-10-02 | Last modified: | 2024-01-24 | Method: | X-RAY DIFFRACTION (1.8 Å) | Cite: | Constrained Peptides with Fine-Tuned Flexibility Inhibit NF-Y Transcription Factor Assembly. Angew.Chem.Int.Ed.Engl., 58, 2019
|
|
4G92
| CCAAT-binding complex from Aspergillus nidulans with DNA | Descriptor: | DNA, HAPB protein, HapE, ... | Authors: | Huber, E.M, Scharf, D.H, Hortschansky, P, Groll, M, Brakhage, A.A. | Deposit date: | 2012-07-23 | Release date: | 2012-10-31 | Last modified: | 2023-09-13 | Method: | X-RAY DIFFRACTION (1.8 Å) | Cite: | DNA Minor Groove Sensing and Widening by the CCAAT-Binding Complex. Structure, 20, 2012
|
|
4WNN
| SPT16-H2A-H2B FACT HISTONE Complex | Descriptor: | Histone H2A.1, Histone H2B.1, PHOSPHATE ION, ... | Authors: | Kemble, D.J, Hill, C.P, Whitby, F.G, Formosa, T, McCullough, L.L. | Deposit date: | 2014-10-13 | Release date: | 2015-10-21 | Last modified: | 2023-09-27 | Method: | X-RAY DIFFRACTION (1.8 Å) | Cite: | FACT Disrupts Nucleosome Structure by Binding H2A-H2B with Conserved Peptide Motifs. Mol.Cell, 60, 2015
|
|
7CIZ
| |
7VZ4
| Cryo-EM structure of human nucleosome core particle composed of the Widom 601L DNA sequence | Descriptor: | DNA (145-MER), Histone H2A type 1-B/E, Histone H2B type 1-J, ... | Authors: | Takizawa, Y, Ho, C.-H, Sato, S, Danev, R, Kurumizaka, H. | Deposit date: | 2021-11-15 | Release date: | 2023-05-17 | Method: | ELECTRON MICROSCOPY (1.89 Å) | Cite: | Methods for High Resolution Cryo-EM Analyses of Nucleosomes To Be Published
|
|
5CHL
| Structural basis of H2A.Z recognition by YL1 histone chaperone component of SRCAP/SWR1 chromatin remodeling complex | Descriptor: | Histone H2A.Z, Vacuolar protein sorting-associated protein 72 homolog | Authors: | Shan, S, Liang, X, Pan, L, Wu, C, Zhou, Z. | Deposit date: | 2015-07-10 | Release date: | 2016-03-09 | Last modified: | 2017-09-27 | Method: | X-RAY DIFFRACTION (1.892 Å) | Cite: | Structural basis of H2A.Z recognition by SRCAP chromatin-remodeling subunit YL1 Nat.Struct.Mol.Biol., 23, 2016
|
|
1TZY
| Crystal Structure of the Core-Histone Octamer to 1.90 Angstrom Resolution | Descriptor: | CHLORIDE ION, HISTONE H3, HISTONE H4-VI, ... | Authors: | Wood, C.M, Nicholson, J.M, Chantalat, L, Reynolds, C.D, Lambert, S.J, Baldwin, J.P. | Deposit date: | 2004-07-12 | Release date: | 2004-08-03 | Last modified: | 2024-03-13 | Method: | X-RAY DIFFRACTION (1.9 Å) | Cite: | High-resolution structure of the native histone octamer. Acta Crystallogr.,Sect.F, 61, 2005
|
|
4G91
| CCAAT-binding complex from Aspergillus nidulans | Descriptor: | HAPB protein, HapE, Transcription factor HapC (Eurofung) | Authors: | Huber, E.M, Scharf, D.H, Hortschansky, P, Groll, M, Brakhage, A.A. | Deposit date: | 2012-07-23 | Release date: | 2012-10-31 | Last modified: | 2023-09-13 | Method: | X-RAY DIFFRACTION (1.9 Å) | Cite: | DNA Minor Groove Sensing and Widening by the CCAAT-Binding Complex. Structure, 20, 2012
|
|
7BP5
| |
1KX5
| X-Ray Structure of the Nucleosome Core Particle, NCP147, at 1.9 A Resolution | Descriptor: | CHLORIDE ION, DNA (5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGGAATCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3'), DNA (5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGGATTCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3'), ... | Authors: | Davey, C.A, Sargent, D.F, Luger, K, Maeder, A.W, Richmond, T.J. | Deposit date: | 2002-01-31 | Release date: | 2002-12-25 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (1.94 Å) | Cite: | Solvent Mediated Interactions in the Structure of the Nucleosome Core Particle at 1.9 A Resolution J.Mol.Biol., 319, 2002
|
|
4H9Q
| Complex structure 4 of DAXX(E225A)/H3.3(sub5)/H4 | Descriptor: | Death domain-associated protein 6, Histone H3.3, Histone H4, ... | Authors: | Elsasser, S.J, Huang, H, Lewis, P.W, Chin, J.W, Allis, D.C, Patel, D.J. | Deposit date: | 2012-09-24 | Release date: | 2012-10-17 | Last modified: | 2024-02-28 | Method: | X-RAY DIFFRACTION (1.95 Å) | Cite: | DAXX chaperone envelops an H3.3/H4 dimer dictating H3.3-specific read out To be Published
|
|
4H9N
| Complex structure 1 of DAXX/H3.3(sub5)/H4 | Descriptor: | Death domain-associated protein 6, Histone H3.3, Histone H4, ... | Authors: | Elsasser, S.J, Huang, H, Lewis, P.W, Chin, J.W, Allis, D.C, Patel, D.J. | Deposit date: | 2012-09-24 | Release date: | 2012-10-10 | Last modified: | 2024-02-28 | Method: | X-RAY DIFFRACTION (1.95 Å) | Cite: | DAXX chaperone envelops an H3.3/H4 dimer dictating H3.3-specific read out To be Published
|
|
8I17
| Structural basis for H2A-H2B recognitions by human Spt16 | Descriptor: | CHLORIDE ION, FACT complex subunit SPT16, Histone H2A type 1-B/E, ... | Authors: | Huang, H, Li, Y. | Deposit date: | 2023-01-12 | Release date: | 2023-02-22 | Last modified: | 2023-03-08 | Method: | X-RAY DIFFRACTION (1.98 Å) | Cite: | Structural basis for H2A-H2B recognitions by human Spt16. Biochem.Biophys.Res.Commun., 651, 2023
|
|