PDB-8q5i: Structure of Candida albicans 80S ribosome in complex with cephaeline

ID or keywords:

Entry

Database: PDB / ID: 8q5i

Title

Structure of Candida albicans 80S ribosome in complex with cephaeline

Components

(40S ribosomal protein ...) x 23
(60S ribosomal protein ...) x 37
(Ribosomal protein ...) x 10
18S ribosomal RNA
25S rRNA
5.8S rRNA5.8S ribosomal RNA
5S
DNA (5'-R(P*GP*GP*CP*AP*G)-3')
Mixture of endogenous E-tRNAs

Keywords

RIBOSOME /

Candida albicans / cephaeline

Function / homology

Function and homology information

yeast-form cell wall / hyphal cell wall / : / pre-mRNA 5'-splice site binding / negative regulation of mRNA splicing, via spliceosome / protein-RNA complex assembly / maturation of LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) / small-subunit processome / maintenance of translational fidelity /

ribosomal small subunit assembly ...
Similarity search - Function

Ribosomal protein L41 /

Ribosomal protein S21e, conserved site /

Ribosomal protein S26e /

Ribosomal protein S26e superfamily /

Ribosomal protein S26e /

Ribosomal protein L29e /

Ribosomal protein S10, eukaryotic/archaeal /

Ribosomal protein S26e signature. /

Ribosomal protein S17e, conserved site ...

Ribosomal protein L41 /

Ribosomal protein S21e, conserved site /

Ribosomal protein S26e /

Ribosomal protein S26e superfamily /

Ribosomal protein S26e /

Ribosomal protein L29e /

Ribosomal protein S10, eukaryotic/archaeal /

Ribosomal protein S26e signature. /

Ribosomal protein S17e, conserved site /

Ribosomal protein S2, eukaryotic /

Ribosomal protein S30 /

40S ribosomal protein S29/30S ribosomal protein S14 type Z / Ribosomal L29e protein family /

Ribosomal protein S21e /

Ribosomal protein S21e superfamily /

Ribosomal protein S21e /

Ribosomal protein S3, eukaryotic/archaeal /

Ribosomal protein S8e subdomain, eukaryotes /

Ribosomal protein L10e, conserved site /

Ribosomal protein L10e /

Ribosomal protein L27e, conserved site /

Ribosomal protein S19A/S15e /

Ribosomal protein S21e signature. /

Ribosomal protein S30 /

Ribosomal protein S3Ae, conserved site /

Ribosomal protein S17e /

Ribosomal protein S17e-like superfamily /

Ribosomal protein S2, eukaryotic/archaeal /

Ribosomal protein S19e / Ribosomal_S19e /

Ribosomal protein S5, eukaryotic/archaeal /

Ribosomal protein S8e, conserved site /

40S ribosomal protein S11, N-terminal /

40S ribosomal protein S1/3, eukaryotes /

Ribosomal protein S6, eukaryotic /

Ribosomal protein L24e, conserved site /

Ribosomal protein S7e /

40S ribosomal protein S4, C-terminal domain /

Ribosomal protein L34e, conserved site / Eukaryotic Ribosomal Protein L27, KOW domain /

Ribosomal protein S4e, N-terminal, conserved site / Ribosomal S17 /

Ribosomal protein L44e /

Ribosomal protein L38e /

Ribosomal protein L38e superfamily /

Ribosomal protein L27e /

Ribosomal protein L27e superfamily /

Ribosomal protein L22e /

Ribosomal protein L22e superfamily /

Ribosomal protein S19e /

Ribosomal protein S27, zinc-binding domain superfamily / Ribosomal L38e protein family / Ribosomal L22e protein family /

Ribosomal protein L23/L25, N-terminal /

40S Ribosomal protein S10 /

60S ribosomal protein L35 /

Ribosomal protein S17, archaeal/eukaryotic /

Ribosomal protein S27 /

Ribosomal protein S28e conserved site /

Ribosomal protein S6/S6e/A/B/2, conserved site /

Ribosomal protein S28e /

Ribosomal protein L35Ae, conserved site /

Ribosomal protein L30e, conserved site /

40S ribosomal protein S4 C-terminus /

Ribosomal protein S4e, N-terminal /

Ribosomal protein S23, eukaryotic/archaeal / Ribosomal_S17 N-terminal / Plectin/S10, N-terminal /

Ribosomal protein S3Ae / Ribosomal S3Ae family /

Ribosomal protein L44 /

Ribosomal protein L34Ae /

Ribosomal protein S7e /

Ribosomal protein L23, N-terminal domain /

Ribosomal protein L13e, conserved site /

Ribosomal protein L13e signature. / Plectin/S10 domain /

Ribosomal protein S8e / Ribosomal L27e protein family /

Ribosomal protein S4, KOW domain /

Ribosomal Protein L6, KOW domain /

Ribosomal protein S5/S7, eukaryotic/archaeal /

Ribosomal protein S4e /

Ribosomal protein S4e, central region /

Ribosomal protein S4e, central domain superfamily /

Ribosomal protein S6e /

Ribosomal protein S13/S15, N-terminal /

Ribosomal protein S15P / Ribosomal S13/S15 N-terminal domain /

Ribosomal protein S6e /

Ribosomal protein S4/S9, eukaryotic/archaeal /

Ribosomal protein L30/YlxQ /

Ribosomal protein L13e /

Ribosomal protein L13e / RS4NT (NUC023) domain /

Ribosomal protein L34e /

Ribosomal protein L31e, conserved site /

Ribosomal protein L37ae /

Ribosomal protein L14e domain
Similarity search - Domain/homology

Cephaeline /

SPERMIDINE / SPERMINE (FULLY PROTONATED FORM) / : / : / : / : /

RNA / RNA (> 10) / RNA (> 100) ...Cephaeline /

SPERMIDINE / SPERMINE (FULLY PROTONATED FORM) / : / : / : / : /

RNA / RNA (> 10) / RNA (> 100) / RNA (> 1000) / Small ribosomal subunit protein eS4 / Large ribosomal subunit protein eL37 / Large ribosomal subunit protein eL38 / Small ribosomal subunit protein uS19 / Large ribosomal subunit protein eL19 / Large ribosomal subunit protein eL40 / Large ribosomal subunit protein eL22 / Large ribosomal subunit protein eL30 / Small ribosomal subunit protein uS17 / Large ribosomal subunit protein eL43 / Small ribosomal subunit protein eS30 / Small ribosomal subunit protein uS14 /

60S ribosomal protein L42-B /

Ribosomal protein S7 /

40S ribosomal protein S17-B /

40S ribosomal protein S26 /

Ribosomal protein L22 /

60S ribosomal protein L7-A /

60S ribosomal protein L28 /

60S ribosomal protein L33-A /

40S ribosomal protein S27 /

40S ribosomal protein S10-A /

Ribosomal protein S10 /

Ribosomal protein S3 /

40S ribosomal protein S6 /

Ribosomal protein L13 /

Ribosomal protein S5 /

60S ribosomal protein L20 /

40S ribosomal protein S28-B /

60S ribosomal protein L8 /

40S ribosomal protein S1 /

40S ribosomal protein S0 /

40S ribosomal protein S24 /

60S ribosomal protein L9-B /

60S ribosomal protein L23-A /

60S ribosomal protein L24-A /

60S ribosomal protein L18-A /

40S ribosomal protein S19-A /

40S ribosomal protein S7 /

60S ribosomal protein L29 /

40S ribosomal protein S22-A /

40S ribosomal protein S8 /

Ribosomal protein S23 (S12) /

40S ribosomal protein S14-A /

60S ribosomal protein L34-B /

60S ribosomal protein L21-A /

60S ribosomal protein L31-B /

60S ribosomal protein L11-B /

Ribosomal protein S4 /

60S ribosomal protein L2-B /

60S ribosomal protein L14-B /

Ribosomal protein L24 /

40S ribosomal protein S18-B /

40S ribosomal protein S13 /

60S ribosomal protein L4-B /

60S ribosomal protein L13 /

60S ribosomal protein L25 /

Ribosomal protein L29 / Large ribosomal subunit protein eL32 / Small ribosomal subunit protein uS9 / Large ribosomal subunit protein eL36 / Large ribosomal subunit protein eL41 / Large ribosomal subunit protein uL3 / Large ribosomal subunit protein eL15 / Large ribosomal subunit protein uL18 / Large ribosomal subunit protein uL16 / Large ribosomal subunit protein eL39 /

60S ribosomal protein L6 / Large ribosomal subunit protein eL27 / Small ribosomal subunit protein eS21
Similarity search - Component

Biological species

Candida albicans (yeast)
Synthetic construct (others)

Method

ELECTRON MICROSCOPY /

single particle reconstruction /

cryo EM / Resolution: 2.45 Å

Authors

Kolosova, O. / Zgadzay, Y. / Stetsenko, A. / Atamas, A. / Guskov, A. / Yusupov, M.

Funding support

France, 1items

Citation

Journal: Biopolym Cell / Year: 2023
Title: Structural characterization of cephaeline binding to the eukaryotic ribosome using Cryo-Electron Microscopy
Authors: Kolosova, O. / Zgadzay, Y. / Stetsenko, A. / Atamas, A. / Wu, C. / Jenner, L. / Sachs, S.M. / Guskov, A. / Yusupov, M.

History

Deposition	Aug 9, 2023	Deposition site: PDBE / Processing site: PDBE
Revision 1.0	Sep 13, 2023	Provider: repository / Type: Initial release
Revision 1.1	Nov 1, 2023	Group: Derived calculations / Structure summary / Category: chem_comp / entity / pdbx_entity_nonpoly Item: _chem_comp.name / _chem_comp.pdbx_synonyms ..._chem_comp.name / _chem_comp.pdbx_synonyms / _entity.pdbx_description / _pdbx_entity_nonpoly.name
Revision 1.2	Dec 20, 2023	Group: Database references / Category: citation Item: _citation.journal_abbrev / _citation.journal_id_CSD ..._citation.journal_abbrev / _citation.journal_id_CSD / _citation.pdbx_database_id_DOI / _citation.year
Revision 1.3	Jan 31, 2024	Group: Database references / Category: citation / Item: _citation.journal_abbrev / _citation.journal_id_ISSN

Structure viewer	Molecule: MolmilJmol/JSmol

-
Download

PDBx/mmCIF format	8q5i.cif.gz	4.1 MB	Display	PDBx/mmCIF format
PDB format	pdb8q5i.ent.gz		Display	PDB format
PDBx/mmJSON format	8q5i.json.gz		Tree view	PDBx/mmJSON format
Others	Other downloads

-
Validation report

Arichive directory	https://data.pdbj.org/pub/pdb/validation_reports/q5/8q5i ftp://data.pdbj.org/pub/pdb/validation_reports/q5/8q5i	HTTPS FTP

-
Related structure data

Related structure data	18156MC 18150C 18151C 18155C M: map data used to model this data C: citing same article (ref.)
Similar structure data	Similarity search - Function & homologyF&H Search Similarity search - FunctionF&H Search Similarity search - HomologyF&H Search

-
Links

PDB pages	PDBj / wwPDB / NCBI
Related items in Molecule of the Month	#121 - Jan 2010 70S Ribosomes similarity (78) #130 - Oct 2010 Riboswitches similarity (2) #16 - Apr 2001 Aminoacyl-tRNA Synthetases similarity (1) #10 - Oct 2000 Ribosome similarity (79) #157 - Jan 2013 Transfer-Messenger RNA similarity (3) #260 - Aug 2021 Ribonuclease P similarity (7) #253 - Jan 2021 Expressome similarity (3) #181 - Jan 2015 Cascade and CRISPR similarity (1) #229 - Jan 2019 Fluorescent RNA Aptamers similarity (1) #161 - May 2013 Ricin similarity (225) #146 - Feb 2012 Aminoglycoside Antibiotics similarity (4) #15 - Mar 2001 Transfer RNA similarity (1) #249 - Sep 2020 SARS-CoV-2 RNA-dependent RNA Polymerase similarity (1) #210 - Jun 2017 Adenine Riboswitch in Action similarity (1) #87 - Mar 2007 Zinc Fingers similarity (1) #266 - Feb 2022 Oligosaccharyltransferase similarity (104) #226 - Oct 2018 Aminoglycoside Antibiotics and Resistance similarity (3) #245 - May 2020 Spliceosomes similarity (2) #262 - Oct 2021 Fifty Years of Open Access to PDB Structures similarity (3) #65 - May 2005 Self-splicing RNA similarity (2) #98 - Feb 2008 Small Interfering RNA similarity (1) #105 - Sep 2008 Ribonuclease A similarity (1) #227 - Nov 2018 Telomerase similarity (2) #104 - Aug 2008 Selenocysteine Synthase similarity (2) #89 - May 2007 Aconitase and Iron Regulatory Protein 1 similarity (1) #81 - Sep 2006 Elongation Factors similarity (1) #106 - Oct 2008 Poly(A) Polymerase similarity (1) #143 - Nov 2011 Toll-like Receptors similarity (1) #230 - Feb 2019 Initiation Factor eIF4E similarity (1) #60 - Dec 2004 Ubiquitin similarity (4) #241 - Jan 2020 Twenty Years of Molecules similarity (1)

PDB pages

PDBj /

wwPDB /

NCBI

Related items in Molecule of the Month

#121 - Jan 2010
70S Ribosomes
similarity (78)
#130 - Oct 2010
Riboswitches
similarity (2)
#16 - Apr 2001
Aminoacyl-tRNA Synthetases
similarity (1)
#10 - Oct 2000
Ribosome
similarity (79)
#157 - Jan 2013
Transfer-Messenger RNA
similarity (3)
#260 - Aug 2021
Ribonuclease P
similarity (7)
#253 - Jan 2021
Expressome
similarity (3)
#181 - Jan 2015
Cascade and CRISPR
similarity (1)
#229 - Jan 2019
Fluorescent RNA Aptamers
similarity (1)
#161 - May 2013
Ricin
similarity (225)
#146 - Feb 2012
Aminoglycoside Antibiotics
similarity (4)
#15 - Mar 2001
Transfer RNA
similarity (1)
#249 - Sep 2020
SARS-CoV-2 RNA-dependent RNA Polymerase
similarity (1)
#210 - Jun 2017
Adenine Riboswitch in Action
similarity (1)
#87 - Mar 2007
Zinc Fingers
similarity (1)
#266 - Feb 2022
Oligosaccharyltransferase
similarity (104)
#226 - Oct 2018
Aminoglycoside Antibiotics and Resistance
similarity (3)
#245 - May 2020
Spliceosomes
similarity (2)
#262 - Oct 2021
Fifty Years of Open Access to PDB Structures
similarity (3)
#65 - May 2005
Self-splicing RNA
similarity (2)
#98 - Feb 2008
Small Interfering RNA
similarity (1)
#105 - Sep 2008
Ribonuclease A
similarity (1)
#227 - Nov 2018
Telomerase
similarity (2)
#104 - Aug 2008
Selenocysteine Synthase
similarity (2)
#89 - May 2007
Aconitase and Iron Regulatory Protein 1
similarity (1)
#81 - Sep 2006
Elongation Factors
similarity (1)
#106 - Oct 2008
Poly(A) Polymerase
similarity (1)
#143 - Nov 2011
Toll-like Receptors
similarity (1)
#230 - Feb 2019
Initiation Factor eIF4E
similarity (1)
#60 - Dec 2004
Ubiquitin
similarity (4)
#241 - Jan 2020
Twenty Years of Molecules
similarity (1)

Deposited unit

1: 25S rRNA

3: 5S

4: 5.8S rRNA

10: Mixture of endogenous E-tRNAs

j: 60S ribosomal protein L2-B

k: 60S ribosomal protein L3

l: 60S ribosomal protein L4-B

m: 60S ribosomal protein L5

n: 60S ribosomal protein L6

o: 60S ribosomal protein L7-A

p: 60S ribosomal protein L8

q: 60S ribosomal protein L9-B

r: 60S ribosomal protein L10

s: 60S ribosomal protein L11-B

t: 60S ribosomal protein L13

u: 60S ribosomal protein L14-B

v: 60S ribosomal protein L15-A

w: Ribosomal protein L13

x: Ribosomal protein L22

y: 60S ribosomal protein L18-A

z: 60S ribosomal protein L19-A

0: 60S ribosomal protein L20

2: 60S ribosomal protein L21-A

5: 60S ribosomal protein L22-B

6: 60S ribosomal protein L23-A

7: 60S ribosomal protein L24-A

8: 60S ribosomal protein L25

9: Ribosomal protein L24

AA: 60S ribosomal protein L27

AB: 60S ribosomal protein L28

AC: 60S ribosomal protein L29

AD: 60S ribosomal protein L30

AE: 60S ribosomal protein L31-B

AF: 60S ribosomal protein L32

AG: 60S ribosomal protein L33-A

AH: 60S ribosomal protein L34-B

AI: Ribosomal protein L29

AJ: 60S ribosomal protein L36

AK: 60S ribosomal protein L37-B

AL: 60S ribosomal protein L38

AM: 60S ribosomal protein L39

AN: 60S ribosomal protein L40-B

AO: 60S ribosomal protein L41

AP: 60S ribosomal protein L42-B

AQ: 60S ribosomal protein L43-A

A: 18S ribosomal RNA

B: 40S ribosomal protein S0

C: 40S ribosomal protein S1

D: Ribosomal protein S5

E: Ribosomal protein S3

F: 40S ribosomal protein S4

G: Ribosomal protein S7

H: 40S ribosomal protein S6

I: 40S ribosomal protein S7

J: 40S ribosomal protein S8

K: Ribosomal protein S4

L: 40S ribosomal protein S10-A

M: 40S ribosomal protein S11A

O: 40S ribosomal protein S13

P: 40S ribosomal protein S14-A

Q: 40S ribosomal protein S15

R: 40S ribosomal protein S16

S: 40S ribosomal protein S17-B

T: 40S ribosomal protein S18-B

U: 40S ribosomal protein S19-A

V: Ribosomal protein S10

W: 40S ribosomal protein S21

X: 40S ribosomal protein S22-A

Y: Ribosomal protein S23 (S12)

Z: 40S ribosomal protein S24

b: 40S ribosomal protein S26

c: 40S ribosomal protein S27

d: 40S ribosomal protein S28-B

e: 40S ribosomal protein S29A

f: 40S ribosomal protein S30

g: DNA (5'-R(P*GP*GP*CP*AP*G)-3')

hetero molecules

3.02 MDa, 76 polymers
Search similar-shape structures of this assembly by Omokage search (details)

1

Idetical with deposited unit
defined by author
Evidence: electron microscopy, not applicable

-
RNA chain , 6 types, 6 molecules 13410Ag

#1: RNA chain	25S rRNA Mass: 1085306.250 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: GenBank: 1305241335
#2: RNA chain	5S Mass: 38943.129 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: GenBank: X16634.1
#3: RNA chain	5.8S rRNA / 5.8S ribosomal RNA Mass: 50683.906 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: GenBank: OQ195134.1
#4: RNA chain	Mixture of endogenous E-tRNAs Mass: 4461.723 Da / Num. of mol.: 1 / Source method: isolated from a natural source Details: The correct sequence should be GGCAGCAUAGCUCAGUUGGUUAGAGCGUAGGACUCAUAAGCCUAAGGUCACUGGUUCAAUUCCAGUUCUGCUACCA. Like GGCAG - gap - CUGCUACCA Source: (natural) Candida albicans (yeast)
#46: RNA chain	18S ribosomal RNA / Mass: 575838.625 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: GenBank: XR_002086442.1
#76: RNA chain	DNA (5'-R(PGPGPCPAPG)-3') Mass: 1625.048 Da / Num. of mol.: 1 / Source method: obtained synthetically / Source*: (synth.) Synthetic construct (others)

+
60S ribosomal protein ... , 37 types, 37 molecules jklmnopqrstuvyz025678AAABACADAEAFAGAHAJ...

#5: Protein	60S ribosomal protein L2-B / Ribosome Mass: 27366.596 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A8H6F1X9
#6: Protein	60S ribosomal protein L3 / Mass: 44040.848 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: Q59LS1
#7: Protein	60S ribosomal protein L4-B / Ribosome Mass: 39282.352 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A8H6F4H4
#8: Protein	60S ribosomal protein L5 / Mass: 34557.977 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: Q5AGZ7
#9: Protein	60S ribosomal protein L6 / Mass: 19798.002 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: Q9P834
#10: Protein	60S ribosomal protein L7-A / Ribosome Mass: 27446.961 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A8H6BVN2
#11: Protein	60S ribosomal protein L8 / Mass: 28549.424 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A8H6C337
#12: Protein	60S ribosomal protein L9-B / Ribosome Mass: 21755.217 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A8H6C3N3
#13: Protein	60S ribosomal protein L10 / Mass: 25236.297 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: Q5AIB8
#14: Protein	60S ribosomal protein L11-B / Ribosome Mass: 19859.805 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A8H6F1S5
#15: Protein	60S ribosomal protein L13 / Mass: 23105.771 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A8H6F5V7
#16: Protein	60S ribosomal protein L14-B / Ribosome Mass: 14748.476 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A8H6F332
#17: Protein	60S ribosomal protein L15-A / Ribosome Mass: 24389.256 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: Q5A6R1
#20: Protein	60S ribosomal protein L18-A / Ribosome Mass: 20817.367 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A8H6C4Y1
#21: Protein	60S ribosomal protein L19-A / Ribosome Mass: 21942.750 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A1D8PK40
#22: Protein	60S ribosomal protein L20 / Mass: 20376.859 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A8H6BZJ3
#23: Protein	60S ribosomal protein L21-A / Ribosome Mass: 18049.945 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A8H6F1C8
#24: Protein	60S ribosomal protein L22-B / Ribosome Mass: 14107.862 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A1D8PM41
#25: Protein	60S ribosomal protein L23-A / Ribosome Mass: 14508.019 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A8H6C444
#26: Protein	60S ribosomal protein L24-A / Ribosome Mass: 17430.322 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A8H6C4U1
#27: Protein	60S ribosomal protein L25 / Mass: 15873.581 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A8H6F6A1
#29: Protein	60S ribosomal protein L27 / Mass: 15551.407 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: Q9P843
#30: Protein	60S ribosomal protein L28 / Mass: 16703.367 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A8H6BVY8
#31: Protein	60S ribosomal protein L29 / Mass: 7135.336 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A8H6F0G8
#32: Protein	60S ribosomal protein L30 / Mass: 11520.384 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A1D8PM75
#33: Protein	60S ribosomal protein L31-B / Ribosome Mass: 12993.149 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A8H6F1M1
#34: Protein	60S ribosomal protein L32 / Mass: 14993.688 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: O94008
#35: Protein	60S ribosomal protein L33-A / Ribosome Mass: 12138.237 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A8H6BW57
#36: Protein	60S ribosomal protein L34-B / Ribosome Mass: 13774.282 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A8H6F171
#38: Protein	60S ribosomal protein L36 / / L39 Mass: 11096.161 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: P47834
#39: Protein	60S ribosomal protein L37-B / Ribosome Mass: 10102.830 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A1D8PF45
#40: Protein	60S ribosomal protein L38 / Mass: 8911.532 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A1D8PG16
#41: Protein	60S ribosomal protein L39 / / L46 Mass: 6347.549 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: Q96W55
#42: Protein	60S ribosomal protein L40-B / Ribosome Mass: 6078.412 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A1D8PL68
#43: Protein/peptide	60S ribosomal protein L41 / Mass: 3396.280 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: P9WER7
#44: Protein	60S ribosomal protein L42-B / Ribosome Mass: 12285.669 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A8H6BR69
#45: Protein	60S ribosomal protein L43-A / Ribosome Mass: 10136.844 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A1D8PP14

-
Ribosomal protein ... , 10 types, 10 molecules wx9AIDEGKVY

#18: Protein	Ribosomal protein L13 / 60S ribosomal protein L13 Mass: 22685.850 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A8H6BZ56
#19: Protein	Ribosomal protein L22 / 60S ribosomal protein L22 Mass: 21002.861 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A8H6BUG0
#28: Protein	Ribosomal protein L24 / Mass: 14215.550 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A8H6F3X2
#37: Protein	Ribosomal protein L29 / Mass: 14118.759 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A8H6F6B7
#49: Protein	Ribosomal protein S5 / Mass: 26917.314 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A8H6BZ90
#50: Protein	Ribosomal protein S3 / Mass: 27313.570 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A8H6BYS1
#52: Protein	Ribosomal protein S7 / Mass: 25319.922 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A8H6BS29
#56: Protein	Ribosomal protein S4 / Mass: 21765.146 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A8H6F1X2
#66: Protein	Ribosomal protein S10 / Mass: 13366.540 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A8H6BYJ9
#69: Protein	Ribosomal protein S23 (S12) / Ribosome Mass: 16000.784 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A8H6F0V0

+
40S ribosomal protein ... , 23 types, 23 molecules BCFHIJLMOPQRSTUWXZbcdef

#47: Protein	40S ribosomal protein S0 / Mass: 28759.307 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A8H6C395
#48: Protein	40S ribosomal protein S1 / Mass: 29041.859 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A8H6C387
#51: Protein	40S ribosomal protein S4 / Mass: 29435.354 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A1D8PCI6
#53: Protein	40S ribosomal protein S6 / Mass: 27146.469 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A8H6BZ37
#54: Protein	40S ribosomal protein S7 / Mass: 21285.818 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A8H6C655
#55: Protein	40S ribosomal protein S8 / Mass: 22801.979 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A8H6F0S0
#57: Protein	40S ribosomal protein S10-A / Ribosome Mass: 13836.824 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A8H6BWQ8
#58: Protein	40S ribosomal protein S11A / Ribosome Mass: 17638.648 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A1D8PN83
#59: Protein	40S ribosomal protein S13 / Mass: 16976.787 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A8H6F4G0
#60: Protein	40S ribosomal protein S14-A / Ribosome Mass: 14052.112 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A8H6F0V4
#61: Protein	40S ribosomal protein S15 / Mass: 15967.796 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A1D8PK22
#62: Protein	40S ribosomal protein S16 / Mass: 15769.456 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: O94017
#63: Protein	40S ribosomal protein S17-B / Ribosome Mass: 15770.298 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A8H6BTR7
#64: Protein	40S ribosomal protein S18-B / Ribosome Mass: 17023.785 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A8H6F3Y8
#65: Protein	40S ribosomal protein S19-A / Ribosome Mass: 16097.218 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A8H6C5L4
#67: Protein	40S ribosomal protein S21 / Mass: 9652.814 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: Q9P844
#68: Protein	40S ribosomal protein S22-A / Ribosome Mass: 14807.189 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A8H6F0N4
#70: Protein	40S ribosomal protein S24 / Mass: 15546.922 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A8H6C3K1
#71: Protein	40S ribosomal protein S26 / Mass: 13606.099 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A8H6BTS1
#72: Protein	40S ribosomal protein S27 / Mass: 8982.504 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A8H6BWE6
#73: Protein	40S ribosomal protein S28-B / Ribosome Mass: 7536.808 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A8H6C0A5
#74: Protein	40S ribosomal protein S29A / Ribosome Mass: 6615.582 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A1D8PTR4
#75: Protein	40S ribosomal protein S30 / Mass: 7127.437 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A1D8PSK2

-
Non-polymers , 6 types, 1545 molecules

#77: Chemical	ChemComp-SPK / SPERMINE (FULLY PROTONATED FORM) / Spermine Mass: 206.372 Da / Num. of mol.: 1 / Source method: obtained synthetically / Formula: C₁₀H₃₀N₄
#78: Chemical	ChemComp-K16 / Cephaeline / (1~{R})-1-[[(2~{S},3~{R},11~{b}~{S})-3-ethyl-9,10-dimethoxy-2,3,4,6,7,11~{b}-hexahydro-1~{H}-benzo[a]quinolizin-2-yl]methyl]-7-methoxy-1,2,3,4-tetrahydroisoquinolin-6-ol Mass: 466.612 Da / Num. of mol.: 3 / Source method: obtained synthetically / Formula: C₂₈H₃₈N₂O₄ / Feature type: SUBJECT OF INVESTIGATION
#79: Chemical	ChemComp-SPD / SPERMIDINE / N-(2-AMINO-PROPYL)-1,4-DIAMINOBUTANE / PA(34) / Spermidine Mass: 145.246 Da / Num. of mol.: 1 / Source method: obtained synthetically / Formula: C₇H₁₉N₃
#80: Chemical	... ChemComp-MG / MAGNESIUM ION Mass: 24.305 Da / Num. of mol.: 367 / Source method: obtained synthetically / Formula: Mg
#81: Chemical	ChemComp-ZN / ZINC ION Mass: 65.409 Da / Num. of mol.: 7 / Source method: isolated from a natural source / Formula: Zn
#82: Water	ChemComp-HOH / water / Water Mass: 18.015 Da / Num. of mol.: 1166 / Source method: isolated from a natural source / Formula: H₂O

-
Details

Has ligand of interest	Y

-
Experiment

Experiment	Method: ELECTRON MICROSCOPY
EM experiment	Aggregation state: PARTICLE / 3D reconstruction method: single particle reconstruction

-
Sample preparation

Component	Name: Candida albicans 80S ribosome in complex with cephaeline Type: RIBOSOME / Entity ID: #1-#75 / Source: NATURAL
Molecular weight	Experimental value: NO
Source (natural)	Organism: Candida albicans (yeast)
Buffer solution	pH: 7.5
Specimen	Embedding applied: NO / Shadowing applied: NO / Staining applied: NO / Vitrification applied: YES
Vitrification	Cryogen name: ETHANE

-
Electron microscopy imaging

Experimental equipment	Model: Titan Krios / Image courtesy: FEI Company
Microscopy	Model: FEI TITAN KRIOS
Electron gun	Electron source: FIELD EMISSION GUN / Accelerating voltage: 300 kV / Illumination mode: FLOOD BEAM
Electron lens	Mode: BRIGHT FIELDBright-field microscopy / Nominal defocus max: 2400 nm / Nominal defocus min: 900 nm
Image recording	Electron dose: 50 e/Å² / Film or detector model: GATAN K3 (6k x 4k)

-
Processing

EM software

Name: PHENIX / Version: 1.19rc4_4035: / Category: model refinement

CTF correction

Type: PHASE FLIPPING AND AMPLITUDE CORRECTION

3D reconstruction

Resolution: 2.45 Å / Resolution method: FSC 3 SIGMA CUT-OFF / Num. of particles: 254047 / Symmetry type: POINT

Refine LS restraints

Refine-ID	Type	Dev ideal	Number
ELECTRON MICROSCOPY	f_bond_d	0.006	202012
ELECTRON MICROSCOPY	f_angle_d	0.744	296622
ELECTRON MICROSCOPY	f_dihedral_angle_d	15.193	70705
ELECTRON MICROSCOPY	f_chiral_restr	0.046	37135
ELECTRON MICROSCOPY	f_plane_restr	0.007	19322

-
News

-
Feb 9, 2022. New format data for meta-information of EMDB entries

New format data for meta-information of EMDB entries

Version 3 of the EMDB header file is now the official format.
The previous official version 1.9 will be removed from the archive.

Related info.:EMDB header

External links:wwPDB to switch to version 3 of the EMDB data model

-
Aug 12, 2020. Covid-19 info

Covid-19 info

URL: https://pdbj.org/emnavi/covid19.php

New page: Covid-19 featured information page in EM Navigator.

Related info.:Covid-19 info / Mar 5, 2020. Novel coronavirus structure data

+
Mar 5, 2020. Novel coronavirus structure data

+
Jan 31, 2019. EMDB accession codes are about to change! (news from PDBe EMDB page)

+
Jul 12, 2017. Major update of PDB

-
Yorodumi

Thousand views of thousand structures

Yorodumi is a browser for structure data from EMDB, PDB, SASBDB, etc.
This page is also the successor to EM Navigator detail page, and also detail information page/front-end page for Omokage search.
The word "yorodu" (or yorozu) is an old Japanese word meaning "ten thousand". "mi" (miru) is to see.

Related info.:EMDB / PDB / SASBDB / Comparison of 3 databanks / Yorodumi Search / Aug 31, 2016. New EM Navigator & Yorodumi / Yorodumi Papers / Jmol/JSmol / Function and homology information / Changes in new EM Navigator and Yorodumi

-
Movie

-
Structure viewers

+
Viewer log

-
This page

-
This web site

-
Options

+
Open data

-
Basic information

-
Structure visualization

-
Downloads & links

-
Download

-
Validation report

-
Related structure data

-
Links

-
Assembly

-
Components

-
RNA chain , 6 types, 6 molecules 13410Ag

+
60S ribosomal protein ... , 37 types, 37 molecules jklmnopqrstuvyz025678AAABACADAEAFAGAHAJ...

-
Ribosomal protein ... , 10 types, 10 molecules wx9AIDEGKVY

+
40S ribosomal protein ... , 23 types, 23 molecules BCFHIJLMOPQRSTUWXZbcdef

-
Non-polymers , 6 types, 1545 molecules

-
Details

-
Experimental details

-
Experiment

-
Sample preparation

-
Electron microscopy imaging

-
Processing

+
About Yorodumi

-
News

-
Feb 9, 2022. New format data for meta-information of EMDB entries

-
Aug 12, 2020. Covid-19 info

+
Mar 5, 2020. Novel coronavirus structure data

+
Jan 31, 2019. EMDB accession codes are about to change! (news from PDBe EMDB page)

+
Jul 12, 2017. Major update of PDB

-
Yorodumi

-Movie

-Structure viewers

+Viewer log

-This page

-This web site

-Options

+Open data

-Basic information

-Structure visualization

-Downloads & links

-Download

-Validation report

-Related structure data

-Links

-Assembly

-Components

-RNA chain , 6 types, 6 molecules 13410Ag

+60S ribosomal protein ... , 37 types, 37 molecules jklmnopqrstuvyz025678AAABACADAEAFAGAHAJ...

-Ribosomal protein ... , 10 types, 10 molecules wx9AIDEGKVY

+40S ribosomal protein ... , 23 types, 23 molecules BCFHIJLMOPQRSTUWXZbcdef

-Non-polymers , 6 types, 1545 molecules

-Details

-Experimental details

-Experiment

-Sample preparation

-Electron microscopy imaging

-Processing

+About Yorodumi

-News

-Feb 9, 2022. New format data for meta-information of EMDB entries

-Aug 12, 2020. Covid-19 info

+Mar 5, 2020. Novel coronavirus structure data

+Jan 31, 2019. EMDB accession codes are about to change! (news from PDBe EMDB page)

+Jul 12, 2017. Major update of PDB

-Yorodumi

-
Movie

-
Structure viewers

+
Viewer log

-
This page

-
This web site

-
Options

+
Open data

-
Basic information

-
Structure visualization

-
Downloads & links

-
Download

-
Validation report

-
Related structure data

-
Links

-
Assembly

-
Components

-
RNA chain , 6 types, 6 molecules 13410Ag

+
60S ribosomal protein ... , 37 types, 37 molecules jklmnopqrstuvyz025678AAABACADAEAFAGAHAJ...

-
Ribosomal protein ... , 10 types, 10 molecules wx9AIDEGKVY

+
40S ribosomal protein ... , 23 types, 23 molecules BCFHIJLMOPQRSTUWXZbcdef

-
Non-polymers , 6 types, 1545 molecules

-
Details

-
Experimental details

-
Experiment

-
Sample preparation

-
Electron microscopy imaging

-
Processing

+
About Yorodumi

-
News

-
Feb 9, 2022. New format data for meta-information of EMDB entries

-
Aug 12, 2020. Covid-19 info

+
Mar 5, 2020. Novel coronavirus structure data

+
Jan 31, 2019. EMDB accession codes are about to change! (news from PDBe EMDB page)

+
Jul 12, 2017. Major update of PDB

-
Yorodumi