Movie controller

-

    -

    -


    Orientation:

    Jmol status

    -

    -
    Mouse picking

    ID:- Chain:- Residue:- Atom:-
    [English] 日本語
    Yorodumi
    - EMDB-5127: Three-dimensional EM structure of an intact activator-dependent t... -

    +
    Open data

    ID or keywords:

    Loading...

    no data

    -
    Basic information

    Entry
    Database: EMDB / ID: 5127
    TitleThree-dimensional EM structure of an intact activator-dependent transcription initiation complex
    Keywordstranscription / initiation / Class I / activator / RNA polymerase / holoenzyme / sigma70 / open complex / CAP / CRP / cAMP-dependent / DNA / prokaryotic
    SampleE. coli RNA polymerase holoenzyme (sigma70) and E. coli catabolite activator protein (CAP) bound to 98-mer DNA containing the lac promoter and engineered open transcription bubble
    SourceEscherichia coli / bacteria /
    Unidentified
    Map dataE. coli Class I transcription activation complex
    Methodsingle particle reconstruction, at 19.8 A resolution
    AuthorsHudson BP / Quispe J / Lara S / Kim Y / Berman HM / Arnold E / Ebright RH / Lawson CL
    CitationProc. Natl. Acad. Sci. U.S.A., 2009, 106, 19830-19835

    Proc. Natl. Acad. Sci. U.S.A., 2009, 106, 19830-19835 StrPapers
    Three-dimensional EM structure of an intact activator-dependent transcription initiation complex.
    Brian P Hudson / Joel Quispe / Samuel Lara-González / Younggyu Kim / Helen M Berman / Eddy Arnold / Richard H Ebright / Catherine L Lawson

    DateDeposition: Jul 30, 2009 / Header (metadata) release: Aug 24, 2009 / Map release: Nov 4, 2009 / Last update: Jul 30, 2009

    -
    Structure visualization

    Movie
    • Surface view with section colored by density value
    • Surface level: 2.8
    • Imaged by UCSF CHIMERA
    • Download
    • Surface view colored by radius
    • Surface level: 2.8
    • Imaged by UCSF CHIMERA
    • Download
    • Surface view with fitted model
    • Atomic models: : PDB-3iyd
    • Surface level: 2.8
    • Imaged by UCSF CHIMERA
    • Download
    3D viewer /

    View / / Stereo:
    Center
    Zoom
    Scale
    slabnear <=> far

    fix: /
    Orientation
    Orientation Rotation
    misc. /
    Show/hide
    Supplemental images

    Downloads & links

    -
    Map

    Fileemd_5127.map.gz (map file in CCP4 format, 2001 KB)
    Projections & slicesSize of images:
    AxesZ (Sec.)Y (Row.)X (Col.)
    80 pix
    4.64 A/pix
    = 371.2 A
    80 pix
    4.64 A/pix
    = 371.2 A
    80 pix
    4.64 A/pix
    = 371.2 A

    Surface

    Projections

    Slices (1/3)

    Slices (1/2)

    Slices (2/3)

    Images are generated by Spider package.

    Voxel sizeX=Y=Z: 4.64 A
    Density
    Contour Level:2.8 (by author), 2.8 (movie #1):
    Minimum - Maximum-3.34078479 - 14.39524174
    Average (Standard dev.)0E-8 (0.90271008)
    Details

    EMDB XML:

    Space Group Number1
    Map Geometry
    Axis orderXYZ
    Dimensions808080
    Origin-40-40-40
    Limit393939
    Spacing808080
    CellA=B=C: 371.19998 A
    Alpha=beta=gamma: 90 deg.

    CCP4 map header:

    modeImage stored as Reals
    A/pix X/Y/Z4.644.644.64
    M x/y/z808080
    origin x/y/z0.0000.0000.000
    length x/y/z371.200371.200371.200
    alpha/beta/gamma90.00090.00090.000
    start NX/NY/NZ-34-26-72
    NX/NY/NZ6953145
    MAP C/R/S123
    start NC/NR/NS-40-40-40
    NC/NR/NS808080
    D min/max/mean-3.34114.395-0.000

    -
    Supplemental data

    -
    Sample components

    -
    Entire E. coli RNA polymerase holoenzyme (sigma70) and E. coli catabolit...

    EntireName: E. coli RNA polymerase holoenzyme (sigma70) and E. coli catabolite activator protein (CAP) bound to 98-mer DNA containing the lac promoter and engineered open transcription bubble
    Details: Complex formation was verified by gel shift / Number of components: 3
    Oligomeric State: One molecule of RNAP (containing six subunits) and one CAP homodimer bound to a DNA duplex)
    MassTheoretical: 570 kDa

    -
    Component #1: protein, Catabolite Activator Protein

    ProteinName: Catabolite Activator Protein / a.k.a: CAP / Oligomeric Details: homodimer / Number of Copies: 1 / Recombinant expression: Yes
    MassTheoretical: 50 kDa
    SourceSpecies: Escherichia coli / bacteria / / Strain: K12
    Source (engineered)Expression System: Escherichia coli bl21(de3) / bacteria / image: Escherichia coli
    Vector: pET21(a)
    External referencesGene Ontology: GO: 0006355 / InterPro: InterPro: 001808

    -
    Component #2: nucleic-acid, lac(ICAP)UP-UV5-bubble

    Nucleic-acidName: lac(ICAP)UP-UV5-bubble / a.k.a: lac(ICAP)UP-UV5-bubble / Class: DNA
    Details: An engineered 98mer duplex based on positions -78 to 20 of the Class I CAP-dependent promoter lac but containing consensus -10 sequence and consensus binding sites for CAP and RNAP alpha-CTD. Positions -11 to 2 are non-complementary to create an artificial transcription bubble. Top strand 5'-CGCAATAAATGTGATCTAGATCACATTTTAGGCAAAAAAGGCTTTACACTTTATGCTTCCGGCTCGTATAATCGCACCTTATGTGAGCGGATAACAAG-3' Bottom strand 5'-CTTGTTATCCGCTCACAATTCCACACTAATAACGAGCCGGAAGCATAAAGTGTAAAGCCTTTTTTGCCTAAAATGTGATCTAGATCACATTTATTGCG-3'
    Structure: OTHER / Synthetic: Yes
    MassTheoretical: 60 kDa / Experimental: 60 kDa
    SourceSpecies: Unidentified

    -
    Component #3: protein, RNA polymerase holoenzyme (sigma70)

    ProteinName: RNA polymerase holoenzyme (sigma70) / a.k.a: RNAP / Oligomeric Details: heterohexamer
    Details: Six subunits include alphaI (RpoA), alphaII (RpoA), beta (RpoB), beta prime (RpoC) with C-terminal 6His-tag, omega (RpoZ), and sigma70.
    Recombinant expression: Yes / Number of Copies: 1
    MassTheoretical: 460 kDa
    SourceSpecies: Escherichia coli / bacteria / / Strain: K12
    Source (engineered)Expression System: Escherichia coli bl21(de3) / bacteria / image: Escherichia coli
    Vector: pEcABC-H6, pRSFduet-sigma, pCDF-omega
    External referencesGene Ontology: GO: 0006351

    +
    Experimental details

    -
    Sample preparation

    Specimen stateparticle
    Sample solutionSpecimen conc.: 6.18 mg/ml
    Buffer solution: 25mM HEPES, 100mM KCl, 10mM MgCl2, 1mM DTT, 0.2mM cAMP
    pH: 8
    Support film400-mesh copper 2.0x0.5 hole pattern C-flat grid covered with thin layer of continuous carbon
    StainingSample and 2% uranyl formate stain were applied to the grid in rapid succession, with the last drop of stain remaining on the sample for 1 minute. The grid was then submerged in stain and brought up under thin carbon to form an upper sandwich layer. The grid was then blotted and dried for 10 minutes.
    VitrificationInstrument: NONE / Cryogen name: NONE

    -
    Electron microscopy imaging

    ImagingMicroscope: FEI TECNAI F20 / Date: Nov 4, 2008 / Details: 15 um pixel size on detector
    Electron gunElectron source: FIELD EMISSION GUN / Accelerating voltage: 120 kV / Electron dose: 16 e/A2 / Illumination mode: FLOOD BEAM
    LensMagnification: 50000 X (nominal) / Cs: 2 mm / Imaging mode: BRIGHT FIELD / Defocus: 500 - 1500 nm
    Specimen HolderHolder: standard side-entry room-temperature stage / Model: SIDE ENTRY, EUCENTRIC / Temperature: 293 K
    CameraDetector: TVIPS TEMCAM-F415 (4k x 4k)

    -
    Image acquisition

    Image acquisitionNumber of digital images: 349

    -
    Image processing

    ProcessingMethod: single particle reconstruction / Number of class averages: 280 / Number of projections: 14097
    Details: 32816 particles were automatically selected by the Appion DoGpicker initially
    Applied symmetry: C1 (asymmetric)
    3D reconstructionAlgorithm: projection matching / Software: EMAN, SPIDER / CTF correction: ACE
    Details: EMAN interleaved with SPIDER correspondence analysis
    Resolution: 19.8 A / Resolution method: FSC 0.5

    -
    Atomic model buiding

    Modeling #1Software: Chimera, Yup.scx / Refinement protocol: rigid body / Target criteria: map-derived potential energy / Refinement space: REAL
    Details: Protocol: rigid body, Yup.scx simulated annealing. A complete ternary complex model was generated using multiple PDB entries, with a homology modelling step for RNAP. The model was regularized with PHENIX and the refined against the EM map with Yup.scx using default parameters.
    Input PDB model: 1LB2
    Modeling #2Software: Chimera, Yup.scx / Refinement protocol: rigid body / Target criteria: map-derived potential energy / Refinement space: REAL
    Details: Protocol: rigid body fit followed by Yup.scx simulated annealing. A complete ternary complex model was generated using multiple PDB entries, with a homology modelling step for RNAP. The model was regularized with PHENIX and the refined against the EM map with Yup.scx using default parameters.
    Input PDB model: 1BDF
    Modeling #3Software: Chimera, Yup.scx / Refinement protocol: rigid body / Target criteria: map-derived potential energy / Refinement space: REAL
    Details: Protocol: manual fit followed by Yup.scx simulated annealing. A complete ternary complex model was generated using multiple PDB entries, with a homology modelling step for RNAP. The model was regularized with PHENIX and the refined against the EM map with Yup.scx using default parameters.
    Input PDB model: 2AUK
    Chain ID: A
    Modeling #4Software: Chimera, Yup.scx / Refinement protocol: rigid body / Target criteria: map-derived potential energy / Refinement space: REAL
    Details: Protocol: rigid body fit followed by Yup.scx simulated annealing. A complete ternary complex model was generated using multiple PDB entries, with a homology modelling step for RNAP. The model was regularized with PHENIX and the refined against the EM map with Yup.scx using default parameters.
    Input PDB model: 1SIG
    Chain ID: A
    Modeling #5Software: Chimera, Modeller, Yup.scx / Refinement protocol: rigid body / Target criteria: map-derived potential energy / Refinement space: REAL
    Details: Protocol: rigid body fit followed by Yup.scx simulated annealing. A complete ternary complex model was generated using multiple PDB entries, with a homology modelling step for RNAP. The model was regularized with PHENIX and the refined against the EM map with Yup.scx using default parameters.
    Input PDB model: 3DXJ
    Output model

    +
    About Yorodumi

    -
    News

    -
    Sep 15, 2016. EM Navigator & Yorodumi renewed

    EM Navigator & Yorodumi renewed

    • New versions of EM Navigator and Yorodumi started

    Related info.: Changes in new EM Navigator and Yorodumi / EM Navigator (legacy version) / Yorodumi (legacy version)

    -
    Aug 31, 2016. New EM Navigator & Yorodumi

    New EM Navigator & Yorodumi

    • In 15th Sep 2016, the development versions of EM Navigator and Yorodumi will replace the official versions.
    • Current version will continue as 'legacy version' for some time.

    Related info.: Changes in new EM Navigator and Yorodumi / EM Navigator / Yorodumi / EM Navigator (legacy version) / Yorodumi (legacy version)

    +
    Apr 13, 2016. Omokage search got faster

    Omokage search got faster

    • The computation time became ~1/2 compared to the previous version by re-optimization of data accession
    • Enjoy "shape similarity" of biomolecules, more!

    Related info.: Omokage search

    +
    Mar 3, 2016. Presentation (PDF format) at IPR seminar on Feb 19.

    Read more

    -
    Yorodumi

    Thousand views of thousand structures

    • Yorodumi is a browser for structure data from EMDB, PDB, SASBDB, etc.
    • All the functionalities will be ported from the levgacy version.
    • This page is also the successor to EM Navigator detail page, and also detail information page/front-end page for Omokage search.

    Related info.: Yorodumi (legacy version) / EMDB / PDB / SASBDB / Comparison of 3 databanks / Yorodumi Search / Yorodumi Papers / Jmol/JSmol / Changes in new EM Navigator and Yorodumi

    Read more