[English] 日本語
Yorodumi
- EMDB-5127: Three-dimensional EM structure of an intact activator-dependent t... -

+
Open data


ID or keywords:

Loading...

no data

-
Basic information

Entry
Database: EMDB / ID: 5127
TitleThree-dimensional EM structure of an intact activator-dependent transcription initiation complex
Keywordstranscription / initiation / Class I / activator / RNA polymerase / holoenzyme / sigma70 / open complex / CAP / CRP / cAMP-dependent / DNA / prokaryotic
SampleE. coli RNA polymerase holoenzyme (sigma70) and E. coli catabolite activator protein (CAP) bound to 98-mer DNA containing the lac promoter and engineered open transcription bubble
SourceEscherichia coli / bacteria / エシェリキア・コリ, 大腸菌 /
Unidentified
Map dataE. coli Class I transcription activation complex
Methodsingle particle reconstruction, at 19.8 A resolution
AuthorsHudson BP / Quispe J / Lara S / Kim Y / Berman HM / Arnold E / Ebright RH / Lawson CL
CitationProc. Natl. Acad. Sci. U.S.A., 2009, 106, 19830-19835

Proc. Natl. Acad. Sci. U.S.A., 2009, 106, 19830-19835 StrPapers
Three-dimensional EM structure of an intact activator-dependent transcription initiation complex.
Brian P Hudson / Joel Quispe / Samuel Lara-González / Younggyu Kim / Helen M Berman / Eddy Arnold / Richard H Ebright / Catherine L Lawson

DateDeposition: Jul 30, 2009 / Header (metadata) release: Aug 24, 2009 / Map release: Nov 4, 2009 / Last update: Jul 30, 2009

-
Structure visualization

Movie
  • Surface view with section colored by density value
  • Surface level: 2.8
  • Imaged by UCSF CHIMERA
  • Download
  • Surface view colored by radius
  • Surface level: 2.8
  • Imaged by UCSF CHIMERA
  • Download
  • Surface view with fitted model
  • Atomic models: : PDB-3iyd
  • Surface level: 2.8
  • Imaged by UCSF CHIMERA
  • Download
3D viewer


View / / Stereo:
Center
Zoom
Scale
Slabnear <=> far

fix: /
Orientation
Orientation Rotation
Misc. /
Show/hide
Supplemental images

Downloads & links

-
Map

Fileemd_5127.map.gz (map file in CCP4 format, 2001 KB)
Projections & slices
Size
Brightness
Contrast
Others
AxesZ (Sec.)Y (Row.)X (Col.)
80 pix
4.64 A/pix
= 371.2 A
80 pix
4.64 A/pix
= 371.2 A
80 pix
4.64 A/pix
= 371.2 A

Surface

Projections

Slices (1/3)

Slices (1/2)

Slices (2/3)

Images are generated by Spider package.

Voxel sizeX=Y=Z: 4.64 A
Density
Contour Level:2.8 (by author), 2.8 (movie #1):
Minimum - Maximum-3.34078479 - 14.39524174
Average (Standard dev.)0E-8 (0.90271008)
Details

EMDB XML:

Space Group Number1
Map Geometry
Axis orderXYZ
Dimensions808080
Origin-40-40-40
Limit393939
Spacing808080
CellA=B=C: 371.19998 A
Alpha=beta=gamma: 90 deg.

CCP4 map header:

modeImage stored as Reals
A/pix X/Y/Z4.644.644.64
M x/y/z808080
origin x/y/z0.0000.0000.000
length x/y/z371.200371.200371.200
alpha/beta/gamma90.00090.00090.000
start NX/NY/NZ-34-26-72
NX/NY/NZ6953145
MAP C/R/S123
start NC/NR/NS-40-40-40
NC/NR/NS808080
D min/max/mean-3.34114.395-0.000

-
Supplemental data

-
Sample components

-
Entire E. coli RNA polymerase holoenzyme (sigma70) and E. coli catabolit...

EntireName: E. coli RNA polymerase holoenzyme (sigma70) and E. coli catabolite activator protein (CAP) bound to 98-mer DNA containing the lac promoter and engineered open transcription bubble
Details: Complex formation was verified by gel shift / Number of components: 3
Oligomeric State: One molecule of RNAP (containing six subunits) and one CAP homodimer bound to a DNA duplex)
MassTheoretical: 570 kDa

-
Component #1: protein, Catabolite Activator Protein

ProteinName: Catabolite Activator Protein / a.k.a: CAP / Oligomeric Details: homodimer / Number of Copies: 1 / Recombinant expression: Yes
MassTheoretical: 50 kDa
SourceSpecies: Escherichia coli / bacteria / エシェリキア・コリ, 大腸菌 /
Strain: K12
Source (engineered)Expression System: Escherichia coli bl21(de3) / bacteria / image: Escherichia coli
Vector: pET21(a)
External referencesGene Ontology: GO: 0006355 / InterPro: InterPro: 001808

-
Component #2: nucleic-acid, lac(ICAP)UP-UV5-bubble

Nucleic-acidName: lac(ICAP)UP-UV5-bubble / a.k.a: lac(ICAP)UP-UV5-bubble / Class: DNA
Details: An engineered 98mer duplex based on positions -78 to 20 of the Class I CAP-dependent promoter lac but containing consensus -10 sequence and consensus binding sites for CAP and RNAP alpha-CTD. Positions -11 to 2 are non-complementary to create an artificial transcription bubble. Top strand 5'-CGCAATAAATGTGATCTAGATCACATTTTAGGCAAAAAAGGCTTTACACTTTATGCTTCCGGCTCGTATAATCGCACCTTATGTGAGCGGATAACAAG-3' Bottom strand 5'-CTTGTTATCCGCTCACAATTCCACACTAATAACGAGCCGGAAGCATAAAGTGTAAAGCCTTTTTTGCCTAAAATGTGATCTAGATCACATTTATTGCG-3'
Structure: OTHER / Synthetic: Yes
MassTheoretical: 60 kDa / Experimental: 60 kDa
SourceSpecies: Unidentified

-
Component #3: protein, RNA polymerase holoenzyme (sigma70)

ProteinName: RNA polymerase holoenzyme (sigma70) / a.k.a: RNAP / Oligomeric Details: heterohexamer
Details: Six subunits include alphaI (RpoA), alphaII (RpoA), beta (RpoB), beta prime (RpoC) with C-terminal 6His-tag, omega (RpoZ), and sigma70.
Recombinant expression: Yes / Number of Copies: 1
MassTheoretical: 460 kDa
SourceSpecies: Escherichia coli / bacteria / エシェリキア・コリ, 大腸菌 /
Strain: K12
Source (engineered)Expression System: Escherichia coli bl21(de3) / bacteria / image: Escherichia coli
Vector: pEcABC-H6, pRSFduet-sigma, pCDF-omega
External referencesGene Ontology: GO: 0006351

+
Experimental details

-
Sample preparation

Specimen stateparticle
Sample solutionSpecimen conc.: 6.18 mg/ml
Buffer solution: 25mM HEPES, 100mM KCl, 10mM MgCl2, 1mM DTT, 0.2mM cAMP
pH: 8
Support film400-mesh copper 2.0x0.5 hole pattern C-flat grid covered with thin layer of continuous carbon
StainingSample and 2% uranyl formate stain were applied to the grid in rapid succession, with the last drop of stain remaining on the sample for 1 minute. The grid was then submerged in stain and brought up under thin carbon to form an upper sandwich layer. The grid was then blotted and dried for 10 minutes.
VitrificationInstrument: NONE / Cryogen name: NONE

-
Electron microscopy imaging

ImagingMicroscope: FEI TECNAI F20 / Date: Nov 4, 2008 / Details: 15 um pixel size on detector
Electron gunElectron source: FIELD EMISSION GUN / Accelerating voltage: 120 kV / Electron dose: 16 e/A2 / Illumination mode: FLOOD BEAM
LensMagnification: 50000 X (nominal) / Cs: 2 mm / Imaging mode: BRIGHT FIELD / Defocus: 500 - 1500 nm
Specimen HolderHolder: standard side-entry room-temperature stage / Model: SIDE ENTRY, EUCENTRIC / Temperature: 293 K
CameraDetector: TVIPS TEMCAM-F415 (4k x 4k)

-
Image acquisition

Image acquisitionNumber of digital images: 349

-
Image processing

ProcessingMethod: single particle reconstruction / Number of class averages: 280 / Number of projections: 14097
Details: 32816 particles were automatically selected by the Appion DoGpicker initially
Applied symmetry: C1 (asymmetric)
3D reconstructionAlgorithm: projection matching / Software: EMAN, SPIDER / CTF correction: ACE
Details: EMAN interleaved with SPIDER correspondence analysis
Resolution: 19.8 A / Resolution method: FSC 0.5

-
Atomic model buiding

Modeling #1Software: Chimera, Yup.scx / Refinement protocol: rigid body / Target criteria: map-derived potential energy / Refinement space: REAL
Details: Protocol: rigid body, Yup.scx simulated annealing. A complete ternary complex model was generated using multiple PDB entries, with a homology modelling step for RNAP. The model was regularized with PHENIX and the refined against the EM map with Yup.scx using default parameters.
Input PDB model: 1LB2
Modeling #2Software: Chimera, Yup.scx / Refinement protocol: rigid body / Target criteria: map-derived potential energy / Refinement space: REAL
Details: Protocol: rigid body fit followed by Yup.scx simulated annealing. A complete ternary complex model was generated using multiple PDB entries, with a homology modelling step for RNAP. The model was regularized with PHENIX and the refined against the EM map with Yup.scx using default parameters.
Input PDB model: 1BDF
Modeling #3Software: Chimera, Yup.scx / Refinement protocol: rigid body / Target criteria: map-derived potential energy / Refinement space: REAL
Details: Protocol: manual fit followed by Yup.scx simulated annealing. A complete ternary complex model was generated using multiple PDB entries, with a homology modelling step for RNAP. The model was regularized with PHENIX and the refined against the EM map with Yup.scx using default parameters.
Input PDB model: 2AUK
Chain ID: A
Modeling #4Software: Chimera, Yup.scx / Refinement protocol: rigid body / Target criteria: map-derived potential energy / Refinement space: REAL
Details: Protocol: rigid body fit followed by Yup.scx simulated annealing. A complete ternary complex model was generated using multiple PDB entries, with a homology modelling step for RNAP. The model was regularized with PHENIX and the refined against the EM map with Yup.scx using default parameters.
Input PDB model: 1SIG
Chain ID: A
Modeling #5Software: Chimera, Modeller, Yup.scx / Refinement protocol: rigid body / Target criteria: map-derived potential energy / Refinement space: REAL
Details: Protocol: rigid body fit followed by Yup.scx simulated annealing. A complete ternary complex model was generated using multiple PDB entries, with a homology modelling step for RNAP. The model was regularized with PHENIX and the refined against the EM map with Yup.scx using default parameters.
Input PDB model: 3DXJ
Output model

+
About Yorodumi

-
News

-
Sep 15, 2016. EM Navigator & Yorodumi renewed

EM Navigator & Yorodumi renewed

  • New versions of EM Navigator and Yorodumi started

Related info.: Changes in new EM Navigator and Yorodumi / EM Navigator (legacy version) / Yorodumi (legacy version)

-
Aug 31, 2016. New EM Navigator & Yorodumi

New EM Navigator & Yorodumi

  • In 15th Sep 2016, the development versions of EM Navigator and Yorodumi will replace the official versions.
  • Current version will continue as 'legacy version' for some time.

Related info.: Changes in new EM Navigator and Yorodumi / EM Navigator / Yorodumi / EM Navigator (legacy version) / Yorodumi (legacy version)

+
Apr 13, 2016. Omokage search got faster

Omokage search got faster

  • The computation time became ~1/2 compared to the previous version by re-optimization of data accession
  • Enjoy "shape similarity" of biomolecules, more!

Related info.: Omokage search

+
Mar 3, 2016. Presentation (PDF format) at IPR seminar on Feb 19.

Read more

-
Yorodumi

Thousand views of thousand structures

  • Yorodumi is a browser for structure data from EMDB, PDB, SASBDB, etc.
  • All the functionalities will be ported from the levgacy version.
  • This page is also the successor to EM Navigator detail page, and also detail information page/front-end page for Omokage search.

Related info.: Yorodumi (legacy version) / EMDB / PDB / SASBDB / Comparison of 3 databanks / Yorodumi Search / Yorodumi Papers / Jmol/JSmol / Changes in new EM Navigator and Yorodumi

Read more