3D Electron Microscopy (3D-EM) Data Navigator [English / 日本語]
Top Gallery List Diagram Statistics Viewer Documents
Movie pageYodrodumi (structure viewer)
PDBj>EM Navigator>Detail page - EMDB-5242

B. subtilis RNase P RNA Specificity domain folding intermediate

by single particle reconstruction, at 15.2 A resolution

Movie

Orientation:

#1: Surface view with section colored by density value, Surface level: 0.0623, Made by UCSF CHIMERA

#2: Surface view colored by radius, Surface level: 0.0623, Made by UCSF CHIMERA

Entry
Summary
Database / IDEM DATA BANK (EMDB) / 5242
TitleB. subtilis RNase P RNA Specificity domain folding intermediate
MapThis is a map of the folding intermediate of B. subtilis RNase P Specificity domain
SampleB. subtilis RNase P RNA Specificity domain folding intermediate
KeywordsRNA folding intermediate RNase P Specificity domain
AuthorsBaird NJ, Ludtke SJ, Khant H, Chiu W, Pan T, Sosnick TR
DateDeposition: 2010-10-27, Header release: 2010-12-22, Map release: 2010-12-22, Last update: 2010-12-22
EMDB SitesEMDB @PDBe (EU), EMDB @RCSB (USA)
Structure Visualization
MoviesMovie Page

#1: Surface view with section colored by density value, Surface level: 0.0623, Made by UCSF CHIMERA

#2: Surface view colored by radius, Surface level: 0.0623, Made by UCSF CHIMERA

Supplemental images
Structure viewersYorodumi, Launch PeppeR (About PeppeR), Volume viewer (RCSB, PDBe)
Related Structure Data
Related Entries

Cite: data citing same article

Similar strucutres (beta)
List of similar structure data about Omokage system
Article
Citation - Primary
ArticleJ. Am. Chem. Soc., Vol. 132, Issue 46, Page 16352-3, Year 2010
TitleDiscrete structure of an RNA folding intermediate revealed by cryo-electron microscopy.
AuthorsNathan J Baird, Steven J Ludtke, Htet Khant, Wah Chiu, Tao Pan, Tobin R Sosnick
Department of Biochemistry and Molecular Biology, University of Chicago, Chicago, Illinois 60637, United States.
KeywordsAmino Acid Sequence, Bacillus (enzymology), Circular Dichroism, Cryoelectron Microscopy, Models, Molecular, Molecular Sequence Data, Ribonuclease P (chemistry, 3.1.26.5)
LinksDOI: 10.1021/ja107492b, PubMed: 21038867, PMC: PMC2988076
Map
Fileemd_5242.map.gz ( map file in CCP4 format, 16001 KB )
Projections & SlicesSize of images:
AxesZ (Sec.)Y (Row.)X (Col.)
160 pix
1.81 A/pix
= 289.6 A
160 pix
1.81 A/pix
= 289.6 A
160 pix
1.81 A/pix
= 289.6 A

Surface

Projections

Slices (1/3)

Slices (1/2)

Slices (2/3)

Images are generated by Spider package.

Density
Contour Level:0.0623 (by author), 0.0623 (movie #1):
Minimum - Maximum: -0.0857854 - 2.4607
Average (Standard dev.): 0.00539513 (0.0740782)
Data TypeImage stored as Reals
Space Group Number1
Map Geometry
Axis orderXYZ
Dimensions160160160
Origin-80-80-80
Limit797979
Spacing160160160
Unit CellA= B= C: 289.6 A
Alpha=beta=gamma: 90 degrees
Pixel SpacingX= Y= Z: 1.81 A
CCP4 map header info
modeImage stored as Reals
A/pix X/Y/Z1.811.811.81
M x/y/z160160160
origin x/y/z-144.800-144.800-144.800
length x/y/z289.600289.600289.600
alpha/beta/gamma90.00090.00090.000
start NX/NY/NZ-62-62-62
NX/NY/NZ125125125
MAP C/R/S123
start NC/NR/NS-80-80-80
NC/NR/NS160160160
start NC,NX/NR,NY/NS,NZ
NC,NX/NR,NY/NS,NZ
D min/max/mean-0.0862.4610.005
Annotation DetailsThis is a map of the folding intermediate of B. subtilis RNase P Specificity domain
Supplement
Images
Images
Sample
NameB. subtilis RNase P RNA Specificity domain folding intermediate
Number of Components1
Oligomeric StateMonomer of Specificity domain
Theoretical Mass0.05MDa
Detailsnone
Mass-estimation MethodCalculation from nucleotide sequence, 154mer RNA
Component #1: nucleic-acid - RNase P RNA Specificity domain
Scientific nameRNA
Common NameRNase P RNA Specificity domain
Theoretical Mass0.05 MDa
Scientific Name of SpeciesBacillus subtilis

Common Name of SpeciesBacteria
NCBI taxonomy1423
SequenceGCGAGCCUAGCGAAGUCAUAAGCUAGGGCAGUCUUUAGAGGCUGACGGCA GGAAAAAAGCCUACGUCUUCGGAUAUGGCUGAGUAUCCUUGAAAGUGCCA CAGUGACGAAGUCUCACUAGAAAUGGUGAGAGUGGAACGCGGUAAACCCC UCGC
StructureOTHER
ClassRNA
SyntheticNo
Experiment
Sample Preparation
Specimen Conc1 mg/ml
Specimen Support Details400 mesh carbon grid
Specimen Stateparticle
BufferDetails: 1 mM MgCl2, 20 mM TrisHCl pH 8
pH: 8
Vitrification
Method2 blots 1 second each before plunging
Cryogen NameETHANE
DetailsVitrification instrument: FEI Vitrobot mark III
Humidity100
InstrumentFEI VITROBOT MARK III
Temperature77 Kelvin
Imaging
MicroscopeJEOL 2010F
Date10-MAR-2006
Electron Gun
Electron SourceFIELD EMISSION GUN
Accelerating Voltage200 kV
Electron Dose16 e/A**2
Illumination ModeFLOOD BEAM
Lens
MagnificationNominal: 60000
Astigmatismobject astigmatism correction made at 400,000 times magnification
Nominal Cs2 mm
Imaging ModeBRIGHT FIELD
Defocus1000 nm - 3500 nm
Specimen Holder
Holdersingle tilt cryo-holder
ModelGATAN LIQUID NITROGEN
Temperature94.1 K ( 93 - 95 K)
Camera
DetectorGATAN ULTRASCAN 4000 (4k x 4k)
Image Acquisition
Number of Digital Images100
Processing
Methodsingle particle reconstruction
3D reconstruction
AlgorithmCross-common lines
SoftwareEMAN
DetailsFSC gives a resolution of 15.2 A, but the model was low-pass filtered to 26 A, corresponding to the first zero-crossing of the data. CTF correction was not performed.
Resolution By Author15.2 A
Resolution MethodFSC 0.5
Single Particle
Number of Class Averages60
Number of Projections11600
DetailsThe particles were selected using an automatic selection program and then inspected manually
Download
Data from EMDB
Header (meta data in XML format)emd-5242.xml (7.5 KB)
Map dataemd_5242.map.gz (14.1 MB)
Imagesemd_5242_1.tif (34.7 KB)
FTP directoryftp://ftp.pdbj.org/pub/emdb/structures/EMD-5242
Movie files
movie #1
.mp4 (H.264/MPEG-4 AVC format), 3.5 MB
.webm (WebM/VP8 format), 3.9 MB
Session file for UCSF-Chimera, 26.4 KB
movie #2
.mp4 (H.264/MPEG-4 AVC format), 3.3 MB
.webm (WebM/VP8 format), 3.9 MB
Session file for UCSF-Chimera, 26.5 KB