3D Electron Microscopy (3D-EM) Data Navigator [English / 日本語]
Top Gallery List Diagram Statistics Viewer Documents
Movie pageYodrodumi (structure viewer)
PDBj>EM Navigator>Detail page - EMDB-1054

Large T antigen on the simian virus 40 origin of replication: a 3D snapshot prior to DNA replication.

by single particle reconstruction, at 27.5 A resolution

Movie

Orientation:

#1: Surface view with section colored by density value, Surface level: 0.0016, Image by UCSF CHIMERA

#2: Surface view colored by cylindrical radius, Surface level: 0.0016, Image by UCSF CHIMERA

Entry
Summary
Database / IDEM DATA BANK (EMDB) / 1054
TitleLarge T antigen on the simian virus 40 origin of replication: a 3D snapshot prior to DNA replication.
Map3D volume of the SV40 T antigen double hexamer on the viral origin of replication
SampleLarge T antigen double hexamer on the SV40 origin of replication
AuthorsGomez-Lorenzo MG, Valle M, Frank J, Gruss C, Sorzano COS, Chen XS, Donate L, Carazo JM
DateDeposition: 2003-08-12, Header release: 2003-09-25, Map release: 2005-09-25, Last update: 2011-05-26
EMDB SitesEMDB @PDBe (EU), EMDB @RCSB (USA)
Structure Visualization
MoviesMovie Page

#1: Surface view with section colored by density value, Surface level: 0.0016, Image by UCSF CHIMERA

#2: Surface view colored by cylindrical radius, Surface level: 0.0016, Image by UCSF CHIMERA

Supplemental images
Structure viewersYorodumi, Launch PeppeR (About PeppeR), Volume viewer (RCSB, PDBe)
Related Structure Data
Similar strucutres (beta)
List of similar structure data about Omokage system
Article
Citation - Primary
ArticleEMBO J., Vol. 22, Issue 23, Page 6205-13, Year 2003
TitleLarge T antigen on the simian virus 40 origin of replication: a 3D snapshot prior to DNA replication.
AuthorsMaria G Gomez-Lorenzo, Mikel Valle, Joachim Frank, Claudia Gruss, Carlos Oscar S Sorzano, Xiaojiang S Chen, Luis Enrique Donate, Jose Maria Carazo
Centro Nacional de Biotecnología, Campus Universidad Autónoma, 28049 Madrid, Spain.
KeywordsAlgorithms, Antigens, Viral, Tumor (chemistry), Base Sequence, Crystallography, X-Ray, DNA Primers, DNA Replication, DNA, Viral (chemistry), Image Processing, Computer-Assisted, Molecular Sequence Data, Polymerase Chain Reaction, Protein Conformation, Replication Origin (genetics), Simian virus 40 (genetics)
LinksPubMed: 14633980, DOI: 10.1093/emboj/cdg612, PMC: PMC291853
Map
Fileemd_1054.map.gz ( map file in CCP4 format, 6751 KB )
Projections & SlicesSize of images:
AxesZ (Sec.)Y (Row.)X (Col.)
120 pix
3.27 A/pix
= 392.4 A
120 pix
3.27 A/pix
= 392.4 A
120 pix
3.27 A/pix
= 392.4 A

Surface

Projections

Slices (1/3)

Slices (1/2)

Slices (2/3)

Images are generated by Spider package.

Density
Contour Level:0.000588, 0.0016 (movie #1):
Minimum - Maximum: -0.00605902 - 0.00770981
Average (Standard dev.): -0.00439348 (0.00254601)
Data TypeImage stored as Reals
Space Group Number1
Map Geometry
Axis orderXYZ
Dimensions120120120
Origin000
Limit119119119
Spacing120120120
Unit CellA= B= C: 392.4 A
Alpha=beta=gamma: 90 degrees
Pixel SpacingX= Y= Z: 3.27 A
CCP4 map header info
modeImage stored as Reals
A/pix X/Y/Z3.273.273.27
M x/y/z120120120
origin x/y/z0.0000.0000.000
length x/y/z392.400392.400392.400
alpha/beta/gamma90.00090.00090.000
start NX/NY/NZ0052
NX/NY/NZ12812855
MAP C/R/S123
start NC/NR/NS000
NC/NR/NS120120120
start NC,NX/NR,NY/NS,NZ
NC,NX/NR,NY/NS,NZ
D min/max/mean-0.0060.008-0.004
Annotation Details3D volume of the SV40 T antigen double hexamer on the viral origin of replication
Supplement
Images
Images
Sample
NameLarge T antigen double hexamer on the SV40 origin of replication
Oligomeric Statehomododecamer of T antigen on the DNA
Number of Components2
Theoretical Mass1.049MDa
Component #1: protein - T antigen
Scientific nameSV40 large T antigen
Common NameT antigen
Theoretical Mass0.984 MDa
Experimental Mass0.984 MDa
DetailsPurified as described in Simanis and Lane (1985) Virology, 144:88-100; To know about purification details see Simanis V and Lane DP (1985) "An immunoaffinity purification procedure for SV40 large T antigen". Virology 144, 88-100
Oligomeric Detailsdodecameric
Number of Copies12
Scientific Name of SpeciesSimian virus 40
Common Name of SpeciesSV40
NCBI taxonomy10633
Recombinant expressionYes
Component #2: nucleic-acid - ori
Scientific nameSV40 origin of replication
Common Nameori
Theoretical Mass0.054 MDa
Experimental Mass0.054 MDa
DetailsDNA fragment HindIII / NcoI of pOR1 (DeLucia et al, 1986, J.Virol, 61:3649-3654
Scientific Name of SpeciesSimian virus 40
Common Name of SpeciesSV40
NCBI taxonomy10633
ClassDNA
StructureDOUBLE HELIX
SyntheticYes
SequenceAAGCTTCCTCACTACTTCTGGAATAGCTCAGAGGCCGAGGCGGCCTCGGC CTCTGCATAAATAAAAAAAATTAGGCAGCCATGG
Experiment
Sample Preparation
Specimen Conc7.56 mg/ml
StainingThe sample was vitrified on a carbon-coated copper grid that was previously glow-discharged
Specimen Support Detailscopper grid
Specimen Stateparticle
BufferDetails: The incubation buffer to do the Tag-ori complex: 3 mM ADP, 20 mM Tris (HCl) pH 7.5, 50 mM NaCl, 5 mM KCl, 2 mM MgCl2
pH: 7.5
Vitrification
Cryogen NameETHANE
Temperature90 Kelvin
InstrumentHOMEMADE PLUNGER
MethodBlot for 1 second before plunging
DetailsVitrification instrument: user made plunger. Vitrification carried out at room temperature
Imaging
MicroscopeFEI TECNAI F20
DetailsLow Dose procedure
Electron Gun
Electron SourceFIELD EMISSION GUN
Accelerating Voltage200 kV
Electron Dose15 e/A**2
Illumination ModeFLOOD BEAM
Lens
MagnificationNominal: 60000, Calibrated: 64200
Astigmatismcorrected at 175,000
Nominal Cs2 mm
Imaging ModeBRIGHT FIELD
Defocus1200 nm - 4500 nm
Specimen Holder
HolderSide entry liquid nitrogen-cooled cryo specimen holder
ModelGATAN LIQUID NITROGEN
Tilt Angle0 degrees - 50 degrees
Temperature90 K
Camera
DetectorKODAK SO-163 FILM
Image Acquisition
Number of Digital Images153
Sampling Size7
Quant Bit Number32
ScannerZEISS SCAI
Processing
Methodsingle particle reconstruction
3D reconstruction
AlgorithmART with blobs
Softwarespider xmipp
CTF Correctioneach particle, only phases
Resolution By Author27.5 A
Resolution MethodFSC 0.5
Euler Angles DetailsPhi / theta 186.00 91.000 324.00 41.000 123.00 74.000 213.00 76.000 185.00 84.000 25.000 104.00 172.00 36.000 180.00 97.000 328.00 90.000 284.00 62.000 188.00 112.00 108.00 109.00 297.00 96.000 205.00 102.00 319.00 60.000 297.00 79.000 176.00 142.00 342.00 82.000 314.00 54.000 54.000 99.000 39.000 65.000 346.00 115.00 336.00 94.000 286.00 89.000 254.00 83.000 305.00 45.000 223.00 106.00 219.00 59.000 292.00 104.00 208.00 114.00 262.00 101.00 346.00 62.000 78.000 62.000 170.00 67.000 253.00 77.000 352.00 111.00 178.00 91.000 172.00 45.000 346.00 46.000 169.00 117.00 73.000 63.000 291.00 82.000 13.000 67.000 126.00 58.000 127.00 85.000 276.00 83.000 349.00 70.000 101.00 86.000 350.00 128.00 333.00 55.000 72.000 114.00 322.00 95.000 8.0000 113.00 303.00 73.000 326.00 58.000 148.00 57.000 68.000 35.000 152.00 84.000 168.00 60.000 173.00 46.000 135.00 45.000 36.000 98.000 164.00 78.000 172.00 106.00 197.00 9.0000 103.00 85.000 23.000 147.00 123.00 96.000 242.00 149.00 20.000 73.000 281.00 101.00 118.00 108.00 305.00 54.000 140.00 81.000 15.000 77.000 213.00 70.000 86.000 132.00 329.00 64.000 165.00 82.000 24.000 107.00 89.000 59.000 221.00 102.00 347.00 94.000 248.00 108.00 112.00 27.000 265.00 90.000 190.00 20.000 185.00 118.00 242.00 69.000 295.00 92.000 191.00 99.000 253.00 22.000 232.00 38.000 151.00 126.00 283.00 88.000 233.00 73.000 132.00 74.000 293.00 95.000 27.000 110.00 293.00 136.00 170.00 89.000 260.00 71.000 112.00 144.00 337.00 73.000 143.00 87.000 179.00 94.000 68.000 66.000 223.00 79.000 157.00 113.00 275.00 35.000 358.00 109.00 211.00 87.000 290.00 93.000 347.00 107.00 205.00 44.000 101.00 72.000 246.00 65.000 164.00 68.000 130.00 97.000 345.00 109.00 193.00 102.00 122.00 122.00 254.00 62.000 145.00 56.000 292.00 77.000 350.00 55.000 134.00 67.000 233.00 78.000 15.000 99.000 197.00 58.000 296.00 83.000 246.00 89.000 18.000 106.00 308.00 66.000 21.000 42.000 149.00 101.00 211.00 81.000 313.00 91.000 15.000 103.00 300.00 99.000 153.00 109.00 108.00 142.00 191.00 90.000 345.00 101.00 144.00 144.00 97.000 94.000 224.00 82.000 123.00 105.00 270.00 82.000 239.00 50.000 162.00 69.000 103.00 154.00 2.0000 86.000 106.00 119.00 241.00 107.00 117.00 86.000 180.00 77.000 89.000 114.00 146.00 107.00 143.00 95.000 286.00 109.00 318.00 105.00 306.00 96.000 59.000 91.000 350.00 80.000 185.00 75.000 334.00 100.00 120.00 94.000 90.000 88.000 235.00 52.000 43.000 63.000 90.000 100.00 322.00 90.000 290.00 82.000 118.00 98.000 132.00 72.000 35.000 57.000 167.00 139.00 251.00 104.00 146.00 97.000 340.00 97.000 336.00 46.000 158.00 95.000 163.00 91.000 80.000 110.00 202.00 39.000 340.00 96.000 102.00 82.000 22.000 43.000 153.00 30.000 297.00 74.000 86.000 141.00 191.00 104.00 278.00 102.00 136.00 62.000 118.00 95.000 25.000 77.000 356.00 94.000 162.00 111.00 59.000 101.00 274.00 109.00 107.00 97.000 93.000 84.000 201.00 82.000 258.00 71.000 82.000 40.000 191.00 97.000 347.00 48.000 125.00 112.00 162.00 52.000 330.00 78.000 2.0000 115.00 310.00 119.00 229.00 106.00 229.00 53.000 119.00 79.000 271.00 141.00 103.00 49.000 129.00 122.00 318.00 128.00 195.00 82.000 325.00 92.000 237.00 85.000 222.00 30.000 91.000 110.00 232.00 41.000 115.00 147.00 169.00 101.00 215.00 73.000 15.000 110.00 93.000 95.000 151.00 103.00 160.00 91.000 183.00 100.00 30.000 101.00 24.000 106.00 144.00 90.000 133.00 94.000 179.00 61.000 23.000 96.000 80.000 86.000 187.00 148.00 312.00 168.00 297.00 95.000 94.000 98.000 162.00 66.000 290.00 81.000 301.00 96.000 249.00 94.000 294.00 79.000 220.00 51.000 89.000 84.000 210.00 32.000 294.00 81.000 251.00 85.000 286.00 66.000 329.00 78.000 282.00 57.000 234.00 74.000 274.00 86.000 184.00 70.000 202.00 52.000 164.00 109.00 311.00 67.000 276.00 106.00 86.000 77.000 3.0000 91.000 75.000 48.000 105.00 78.000 333.00 79.000 57.000 69.000 256.00 76.000 282.00 80.000 283.00 138.00 147.00 101.00 319.00 56.000 97.000 88.000 72.000 101.00 210.00 96.000 298.00 79.000 5.0000 70.000 210.00 72.000 289.00 100.00 38.000 132.00 335.00 70.000 259.00 144.00 35.000 116.00 33.000 90.000 3.0000 90.000 145.00 108.00 304.00 40.000 294.00 103.00 309.00 140.00 235.00 108.00 233.00 87.000 113.00 71.000 214.00 57.000 8.0000 66.000 244.00 102.00 309.00 107.00 26.000 107.00 256.00 80.000 102.00 107.00 331.00 106.00 74.000 96.000 314.00 88.000 175.00 23.000 267.00 67.000 269.00 84.000 325.00 82.000 342.00 137.00 276.00 126.00 148.00 94.000 149.00 93.000 77.000 136.00 237.00 43.000 196.00 52.000 131.00 87.000 310.00 96.000 298.00 101.00 308.00 43.000 338.00 83.000 130.00 98.000 264.00 89.000 264.00 93.000 111.00 128.00 287.00 120.00 114.00 64.000 317.00 43.000 287.00 38.000 87.000 72.000 2.0000 73.000 299.00 73.000 23.000 49.000 296.00 110.00 338.00 70.000 53.000 75.000 303.00 81.000 36.000 23.000 333.00 104.00 268.00 99.000 211.00 69.000 348.00 55.000 285.00 99.000 109.00 136.00 109.00 21.000 267.00 102.00 100.00 93.000 278.00 109.00 338.00 134.00 190.00 73.000 89.000 90.000 181.00 85.000 317.00 93.000 93.000 121.00 141.00 104.00 280. ...
DetailsStarting from a preliminary random conical tilt volume, search for projection orientation was done using Radon transforms (Radermacher M, 1994). CTF correction of the images during angular refinement.
Single Particle
Number of Projections13860
DetailsParticles were manually picked and rotationally and translationaly aligned using Radon transforms
Applied SymmetryC1 (asymmetric)
Atomic Model Fitting
Model #0
Refinement Protocolrigid body
DetailsThe helicase hexamer was fitted manually using program O in both C-terminal domains of the Tag-ori complex,
PDB Entry ID1N25
Download
Data from EMDB
Header (meta data in XML format)emd-1054.xml (359.2 KB)
Map dataemd_1054.map.gz (5.2 MB)
Images1054.gif (10.2 KB)
FTP directoryftp://ftp.pdbj.org/pub/emdb/structures/EMD-1054
Movie files
movie #1
.mp4 (H.264/MPEG-4 AVC format), 3.5 MB
.webm (WebM/VP8 format), 5.3 MB
Session file for UCSF-Chimera, 27.3 KB
movie #2
.mp4 (H.264/MPEG-4 AVC format), 3.2 MB
.webm (WebM/VP8 format), 4.6 MB
Session file for UCSF-Chimera, 27.3 KB