Summary Database / ID EM DATA BANK (EMDB) / 1054 Title Large T antigen on the simian virus 40 origin of replication: a 3D snapshot prior to DNA replication. Map 3D volume of the SV40 T antigen double hexamer on the viral origin of replication Sample Large T antigen double hexamer on the SV40 origin of replication Authors Gomez-Lorenzo MG , Valle M , Frank J , Gruss C , Sorzano COS , Chen XS , Donate L , Carazo JM Date Deposition : 2003-08-12, Header release : 2003-09-25, Map release : 2005-09-25, Last update : 2011-05-26EMDB Sites Structure Visualization Movies X Movie Page #1 #2 #1 : Surface view with section colored by density value, Surface level: 0.0016, Made by UCSF CHIMERA
#2 : Surface view colored by cylindrical radius, Surface level: 0.0016, Made by UCSF CHIMERA
Supplemental images
Structure viewers (About PeppeR) , RCSB , PDBe )Related Structure Data Similar strucutres (beta)
Citation - Primary Article EMBO J. , Vol. 22, Issue 23, Page 6205-13, Year 2003Title Large T antigen on the simian virus 40 origin of replication: a 3D snapshot prior to DNA replication. Authors Maria G Gomez-Lorenzo , Mikel Valle , Joachim Frank , Claudia Gruss , Carlos Oscar S Sorzano , Xiaojiang S Chen , Luis Enrique Donate , Jose Maria Carazo Keywords Links
File Projections & Slices Size of images: Axes X SurfaceX X X X
Images are generated by Spider package .
Density
Contour Level: 0.000588 , 0.0016 (movie #1): Minimum - Maximum: -0.00605902 - 0.00770981 Average (Standard dev.): -0.00439348 (0.00254601)
Data Type float (32-bit) Space Group Number 1 Map Geometry Axis Order : X Y Z Dimensions : 120 120 120 Origin : 0 0 0 Limit : 119 119 119 Spacing : 120 120 120
Unit Cell A = 392.4 A , B = 392.4 A , C = 392.4 A , 90 degrees , beta = 90 degrees , gamma = 90 degreesPixel Spacing X = 3.27 A , Y = 3.27 A , Z = 3.27 ACCP4 map header info Show mode Image stored as Reals A/pix X/Y/Z 3.27 3.27 3.27 M x/y/z 120 120 120 origin x/y/z 0.000 0.000 0.000 length x/y/z 392.400 392.400 392.400 alpha/beta/gamma 90.000 90.000 90.000 start NX/NY/NZ 0 0 52 NX/NY/NZ 128 128 55 MAP C/R/S 1 2 3 start NC/NR/NS 0 0 0 NC/NR/NS 120 120 120 start NC,NX/NR,NY/NS,NZ NC,NX/NR,NY/NS,NZ D min/max/mean -0.006 0.008 -0.004
Annotation Details 3D volume of the SV40 T antigen double hexamer on the viral origin of replication
Name Large T antigen double hexamer on the SV40 origin of replication Oligomeric State homododecamer of T antigen on the DNA Number of Components 2 Theoretical Mass 1.049 MDa Component #1: protein - T antigen Scientific name SV40 large T antigen Common Name T antigen Theoretical Mass 0.984 MDa Experimental Mass 0.984 MDa Details Purified as described in Simanis and Lane (1985) Virology, 144:88-100; To know about purification details see Simanis V and Lane DP (1985) "An immunoaffinity purification procedure for SV40 large T antigen". Virology 144, 88-100 Oligomeric Details dodecameric Number of Copies 12 Scientific Name of Species Simian virus 40 (NCBI Taxonomy: Common Name of Species SV40 Recombinant expression Yes Component #2: nucleic-acid - ori Scientific name SV40 origin of replication Common Name ori Theoretical Mass 0.054 MDa Experimental Mass 0.054 MDa Details DNA fragment HindIII / NcoI of pOR1 (DeLucia et al, 1986, J.Virol, 61:3649-3654 Scientific Name of Species Simian virus 40 (NCBI Taxonomy: Common Name of Species SV40 Class DNA Structure DOUBLE HELIX Synthetic Yes Sequence AAGCTTCCTCACTACTTCTGGAATAGCTCAGAGGCCGAGGCGGCCTCGGC CTCTGCATAAATAAAAAAAATTAGGCAGCCATGG
Sample Preparation Specimen Conc 7.56 mg/ml Staining The sample was vitrified on a carbon-coated copper grid that was previously glow-discharged Specimen Support Details copper grid Specimen State particle Buffer Details: The incubation buffer to do the Tag-ori complex: 3 mM ADP, 20 mM Tris (HCl) pH 7.5, 50 mM NaCl, 5 mM KCl, 2 mM MgCl2 pH: 7.5 Vitrification Cryogen Name ETHANE Temperature 90 Kelvin Instrument HOMEMADE PLUNGER Method Blot for 1 second before plunging Details Vitrification instrument: user made plunger. Vitrification carried out at room temperature Imaging Microscope FEI TECNAI F20 Details Low Dose procedure Electron Gun Electron Source FIELD EMISSION GUN Accelerating Voltage 200 kV Electron Dose 15 e/A**2 Illumination Mode FLOOD BEAM Lens Magnification Nominal: 60000 X, Calibrated: 64200 X Astigmatism corrected at 175,000 Nominal Cs 2.0 mm Imaging Mode BRIGHT FIELD Defocus 1200 nm - 4500 nm Specimen Holder Holder Side entry liquid nitrogen-cooled cryo specimen holder ( GATAN LIQUID NITROGEN ) Tilt Angle 0 degrees - 50 degrees Temperature 90 Kelvin Camera Detector Kodak SO163 film Image Acquisition Number of Digital Images 153 Sampling Size 7 microns Quant Bit Number 32 Scanner ZEISS SCAI
Method single particle reconstruction 3 D reconstruction Algorithm ART with blobs Software spider xmipp CTF Correction each particle, only phases Resolution By Author 27.5 Resolution Method FSC at 0.5 cut-off Euler Angles Details Phi / theta 186.00 91.000 324.00 41.000 123.00 74.000 213.00 76.000 185.00 84.000 25.000 104.00 172.00 36.000 180.00 97.000 328.00 90.000 284.00 62.000 188.00 112.00 108.00 109.00 297.00 96.000 205.00 102.00 319.00 60.000 297.00 79.000 176.00 142.00 342.00 82.000 314.00 54.000 54.000 99.000 39.000 65.000 346.00 115.00 336.00 94.000 286.00 89.000 254.00 83.000 305.00 45.000 223.00 106.00 219.00 59.000 292.00 104.00 208.00 114.00 262.00 101.00 346.00 62.000 78.000 62.000 170.00 67.000 253.00 77.000 352.00 111.00 178.00 91.000 172.00 45.000 346.00 46.000 169.00 117.00 73.000 63.000 291.00 82.000 13.000 67.000 126.00 58.000 127.00 85.000 276.00 83.000 349.00 70.000 101.00 86.000 350.00 128.00 333.00 55.000 72.000 114.00 322.00 95.000 8.0000 113.00 303.00 73.000 326.00 58.000 148.00 57.000 68.000 35.000 152.00 84.000 168.00 60.000 173.00 46.000 135.00 45.000 36.000 98.000 164.00 78.000 172.00 106.00 197.00 9.0000 103.00 85.000 23.000 147.00 123.00 96.000 242.00 149.00 20.000 73.000 281.00 101.00 118.00 108.00 305.00 54.000 140.00 81.000 15.000 77.000 213.00 70.000 86.000 132.00 329.00 64.000 165.00 82.000 24.000 107.00 89.000 59.000 221.00 102.00 347.00 94.000 248.00 108.00 112.00 27.000 265.00 90.000 190.00 20.000 185.00 118.00 242.00 69.000 295.00 92.000 191.00 99.000 253.00 22.000 232.00 38.000 151.00 126.00 283.00 88.000 233.00 73.000 132.00 74.000 293.00 95.000 27.000 110.00 293.00 136.00 170.00 89.000 260.00 71.000 112.00 144.00 337.00 73.000 143.00 87.000 179.00 94.000 68.000 66.000 223.00 79.000 157.00 113.00 275.00 35.000 358.00 109.00 211.00 87.000 290.00 93.000 347.00 107.00 205.00 44.000 101.00 72.000 246.00 65.000 164.00 68.000 130.00 97.000 345.00 109.00 193.00 102.00 122.00 122.00 254.00 62.000 145.00 56.000 292.00 77.000 350.00 55.000 134.00 67.000 233.00 78.000 15.000 99.000 197.00 58.000 296.00 83.000 246.00 89.000 18.000 106.00 308.00 66.000 21.000 42.000 149.00 101.00 211.00 81.000 313.00 91.000 15.000 103.00 300.00 99.000 153.00 109.00 108.00 142.00 191.00 90.000 345.00 101.00 144.00 144.00 97.000 94.000 224.00 82.000 123.00 105.00 270.00 82.000 239.00 50.000 162.00 69.000 103.00 154.00 2.0000 86.000 106.00 119.00 241.00 107.00 117.00 86.000 180.00 77.000 89.000 114.00 146.00 107.00 143.00 95.000 286.00 109.00 318.00 105.00 306.00 96.000 59.000 91.000 350.00 80.000 185.00 75.000 334.00 100.00 120.00 94.000 90.000 88.000 235.00 52.000 43.000 63.000 90.000 100.00 322.00 90.000 290.00 82.000 118.00 98.000 132.00 72.000 35.000 57.000 167.00 139.00 251.00 104.00 146.00 97.000 340.00 97.000 336.00 46.000 158.00 95.000 163.00 91.000 80.000 110.00 202.00 39.000 340.00 96.000 102.00 82.000 22.000 43.000 153.00 30.000 297.00 74.000 86.000 141.00 191.00 104.00 278.00 102.00 136.00 62.000 118.00 95.000 ... Details Starting from a preliminary random conical tilt volume, search for projection orientation was done using Radon transforms (Radermacher M, 1994). CTF correction of the images during angular refinement. Single Particle Number of Projections 13860 Details Particles were manually picked and rotationally and translationaly aligned using Radon transforms Atomic Model Fitting Model #0 Refinement Protocol rigid body Details The helicase hexamer was fitted manually using program O in both C-terminal domains of the Tag-ori complex,
Entry
EMDB @PDBe (EU), 
Movie Page
Yorodumi, 
Launch PeppeR (About PeppeR), 
List of similar structure data 
about Omokage system
Article
Algorithms, 
Map
EMD-1054.map ( map file in CCP4 format, 6913 KB )
Supplement
Sample
Experiment
Processing
1054.gif (10.2 KB)
Top
Gallery
List
Diagram
Statistics
Documents
PDBj
EM Navigator
Detail page - EMDB-1054
Z (Sec.)
Y (Row.)
X (Col.)
Contact