[English] 日本語
Yorodumi- EMDB-5127: Three-dimensional EM structure of an intact activator-dependent t... -
+Open data
-Basic information
Entry | Database: EMDB / ID: EMD-5127 | |||||||||
---|---|---|---|---|---|---|---|---|---|---|
Title | Three-dimensional EM structure of an intact activator-dependent transcription initiation complex | |||||||||
Map data | E. coli Class I transcription activation complex | |||||||||
Sample |
| |||||||||
Keywords | transcription / initiation / Class I / activator / RNA polymerase / holoenzyme / sigma70 / open complex / CAP / CRP / cAMP-dependent / DNA / prokaryotic | |||||||||
Function / homology | Function and homology information carbon catabolite repression of transcription / sigma factor antagonist complex / DNA binding, bending / RNA polymerase complex / submerged biofilm formation / cellular response to cell envelope stress / cytosolic DNA-directed RNA polymerase complex / regulation of DNA-templated transcription initiation / sigma factor activity / bacterial-type flagellum assembly ...carbon catabolite repression of transcription / sigma factor antagonist complex / DNA binding, bending / RNA polymerase complex / submerged biofilm formation / cellular response to cell envelope stress / cytosolic DNA-directed RNA polymerase complex / regulation of DNA-templated transcription initiation / sigma factor activity / bacterial-type flagellum assembly / minor groove of adenine-thymine-rich DNA binding / bacterial-type flagellum-dependent cell motility / nitrate assimilation / cAMP binding / transcription elongation factor complex / regulation of DNA-templated transcription elongation / transcription antitermination / DNA-templated transcription initiation / cell motility / protein-DNA complex / ribonucleoside binding / DNA-directed 5'-3' RNA polymerase activity / DNA-directed RNA polymerase / response to heat / protein-containing complex assembly / sequence-specific DNA binding / intracellular iron ion homeostasis / protein dimerization activity / DNA-binding transcription factor activity / response to antibiotic / negative regulation of DNA-templated transcription / DNA-templated transcription / positive regulation of DNA-templated transcription / regulation of DNA-templated transcription / magnesium ion binding / DNA binding / zinc ion binding / identical protein binding / membrane / cytoplasm / cytosol Similarity search - Function | |||||||||
Biological species | Escherichia coli (E. coli) / unidentified (others) | |||||||||
Method | single particle reconstruction / negative staining / Resolution: 19.8 Å | |||||||||
Authors | Hudson BP / Quispe J / Lara S / Kim Y / Berman HM / Arnold E / Ebright RH / Lawson CL | |||||||||
Citation | Journal: Proc Natl Acad Sci U S A / Year: 2009 Title: Three-dimensional EM structure of an intact activator-dependent transcription initiation complex. Authors: Brian P Hudson / Joel Quispe / Samuel Lara-González / Younggyu Kim / Helen M Berman / Eddy Arnold / Richard H Ebright / Catherine L Lawson / Abstract: We present the experimentally determined 3D structure of an intact activator-dependent transcription initiation complex comprising the Escherichia coli catabolite activator protein (CAP), RNA ...We present the experimentally determined 3D structure of an intact activator-dependent transcription initiation complex comprising the Escherichia coli catabolite activator protein (CAP), RNA polymerase holoenzyme (RNAP), and a DNA fragment containing positions -78 to +20 of a Class I CAP-dependent promoter with a CAP site at position -61.5 and a premelted transcription bubble. A 20-A electron microscopy reconstruction was obtained by iterative projection-based matching of single particles visualized in carbon-sandwich negative stain and was fitted using atomic coordinate sets for CAP, RNAP, and DNA. The structure defines the organization of a Class I CAP-RNAP-promoter complex and supports previously proposed interactions of CAP with RNAP alpha subunit C-terminal domain (alphaCTD), interactions of alphaCTD with sigma(70) region 4, interactions of CAP and RNAP with promoter DNA, and phased-DNA-bend-dependent partial wrapping of DNA around the complex. The structure also reveals the positions and shapes of species-specific domains within the RNAP beta', beta, and sigma(70) subunits. | |||||||||
History |
|
-Structure visualization
Movie |
Movie viewer |
---|---|
Structure viewer | EM map: SurfViewMolmilJmol/JSmol |
Supplemental images |
-Downloads & links
-EMDB archive
Map data | emd_5127.map.gz | 1.3 MB | EMDB map data format | |
---|---|---|---|---|
Header (meta data) | emd-5127-v30.xml emd-5127.xml | 18.2 KB 18.2 KB | Display Display | EMDB header |
Images | emd_5127_1.tif | 764.8 KB | ||
Archive directory | http://ftp.pdbj.org/pub/emdb/structures/EMD-5127 ftp://ftp.pdbj.org/pub/emdb/structures/EMD-5127 | HTTPS FTP |
-Validation report
Summary document | emd_5127_validation.pdf.gz | 296.4 KB | Display | EMDB validaton report |
---|---|---|---|---|
Full document | emd_5127_full_validation.pdf.gz | 296 KB | Display | |
Data in XML | emd_5127_validation.xml.gz | 5.2 KB | Display | |
Arichive directory | https://ftp.pdbj.org/pub/emdb/validation_reports/EMD-5127 ftp://ftp.pdbj.org/pub/emdb/validation_reports/EMD-5127 | HTTPS FTP |
-Related structure data
Related structure data | 3iydMC M: atomic model generated by this map C: citing same article (ref.) |
---|---|
Similar structure data |
-Links
EMDB pages | EMDB (EBI/PDBe) / EMDataResource |
---|---|
Related items in Molecule of the Month |
-Map
File | Download / File: emd_5127.map.gz / Format: CCP4 / Size: 1.9 MB / Type: IMAGE STORED AS FLOATING POINT NUMBER (4 BYTES) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Annotation | E. coli Class I transcription activation complex | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Voxel size | X=Y=Z: 4.64 Å | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Density |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Symmetry | Space group: 1 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Details | EMDB XML:
CCP4 map header:
|
-Supplemental data
-Sample components
-Entire : E. coli RNA polymerase holoenzyme (sigma70) and E. coli catabolit...
Entire | Name: E. coli RNA polymerase holoenzyme (sigma70) and E. coli catabolite activator protein (CAP) bound to 98-mer DNA containing the lac promoter and engineered open transcription bubble |
---|---|
Components |
|
-Supramolecule #1000: E. coli RNA polymerase holoenzyme (sigma70) and E. coli catabolit...
Supramolecule | Name: E. coli RNA polymerase holoenzyme (sigma70) and E. coli catabolite activator protein (CAP) bound to 98-mer DNA containing the lac promoter and engineered open transcription bubble type: sample / ID: 1000 / Details: Complex formation was verified by gel shift Oligomeric state: One molecule of RNAP (containing six subunits) and one CAP homodimer bound to a DNA duplex) Number unique components: 3 |
---|---|
Molecular weight | Theoretical: 570 KDa |
-Macromolecule #1: Catabolite Activator Protein
Macromolecule | Name: Catabolite Activator Protein / type: protein_or_peptide / ID: 1 / Name.synonym: CAP / Number of copies: 1 / Oligomeric state: homodimer / Recombinant expression: Yes |
---|---|
Source (natural) | Organism: Escherichia coli (E. coli) / Strain: K12 |
Molecular weight | Theoretical: 50 KDa |
Recombinant expression | Organism: Escherichia coli BL21(DE3) (bacteria) / Recombinant plasmid: pET21(a) |
Sequence | GO: regulation of DNA-templated transcription / InterPro: INTERPRO: IPR001808 |
-Macromolecule #3: RNA polymerase holoenzyme (sigma70)
Macromolecule | Name: RNA polymerase holoenzyme (sigma70) / type: protein_or_peptide / ID: 3 / Name.synonym: RNAP Details: Six subunits include alphaI (RpoA), alphaII (RpoA), beta (RpoB), beta prime (RpoC) with C-terminal 6His-tag, omega (RpoZ), and sigma70. Number of copies: 1 / Oligomeric state: heterohexamer / Recombinant expression: Yes |
---|---|
Source (natural) | Organism: Escherichia coli (E. coli) / Strain: K12 / synonym: Escherichia coli |
Molecular weight | Theoretical: 460 KDa |
Recombinant expression | Organism: Escherichia coli BL21(DE3) (bacteria) / Recombinant plasmid: pEcABC-H6, pRSFduet-sigma, pCDF-omega |
Sequence | GO: DNA-templated transcription |
-Macromolecule #2: lac(ICAP)UP-UV5-bubble
Macromolecule | Name: lac(ICAP)UP-UV5-bubble / type: dna / ID: 2 / Name.synonym: lac(ICAP)UP-UV5-bubble Details: An engineered 98mer duplex based on positions -78 to 20 of the Class I CAP-dependent promoter lac but containing consensus -10 sequence and consensus binding sites for CAP and RNAP alpha-CTD. ...Details: An engineered 98mer duplex based on positions -78 to 20 of the Class I CAP-dependent promoter lac but containing consensus -10 sequence and consensus binding sites for CAP and RNAP alpha-CTD. Positions -11 to 2 are non-complementary to create an artificial transcription bubble. Top strand 5'-CGCAATAAATGTGATCTAGATCACATTTTAGGCAAAAAAGGCTTTACACTTTATGCTTCCGGCTCGTATAATCGCACCTTATGTGAGCGGATAACAAG-3' Bottom strand 5'-CTTGTTATCCGCTCACAATTCCACACTAATAACGAGCCGGAAGCATAAAGTGTAAAGCCTTTTTTGCCTAAAATGTGATCTAGATCACATTTATTGCG-3' Classification: DNA / Structure: OTHER / Synthetic?: Yes |
---|---|
Source (natural) | Organism: unidentified (others) |
Molecular weight | Experimental: 60 KDa / Theoretical: 60 KDa |
-Experimental details
-Structure determination
Method | negative staining |
---|---|
Processing | single particle reconstruction |
Aggregation state | particle |
-Sample preparation
Concentration | 6.18 mg/mL |
---|---|
Buffer | pH: 8 Details: 25mM HEPES, 100mM KCl, 10mM MgCl2, 1mM DTT, 0.2mM cAMP |
Staining | Type: NEGATIVE Details: Sample and 2% uranyl formate stain were applied to the grid in rapid succession, with the last drop of stain remaining on the sample for 1 minute. The grid was then submerged in stain and ...Details: Sample and 2% uranyl formate stain were applied to the grid in rapid succession, with the last drop of stain remaining on the sample for 1 minute. The grid was then submerged in stain and brought up under thin carbon to form an upper sandwich layer. The grid was then blotted and dried for 10 minutes. |
Grid | Details: 400-mesh copper 2.0x0.5 hole pattern C-flat grid covered with thin layer of continuous carbon |
Vitrification | Cryogen name: NONE / Instrument: OTHER |
-Electron microscopy
Microscope | FEI TECNAI F20 |
---|---|
Temperature | Average: 293 K |
Details | 15 um pixel size on detector |
Date | Nov 4, 2008 |
Image recording | Category: CCD / Film or detector model: TVIPS TEMCAM-F415 (4k x 4k) / Number real images: 349 / Average electron dose: 16 e/Å2 |
Electron beam | Acceleration voltage: 120 kV / Electron source: FIELD EMISSION GUN |
Electron optics | Illumination mode: FLOOD BEAM / Imaging mode: BRIGHT FIELD / Cs: 2.0 mm / Nominal defocus max: 1.5 µm / Nominal defocus min: 0.5 µm / Nominal magnification: 50000 |
Sample stage | Specimen holder: standard side-entry room-temperature stage / Specimen holder model: SIDE ENTRY, EUCENTRIC |
Experimental equipment | Model: Tecnai F20 / Image courtesy: FEI Company |
-Image processing
Details | 32816 particles were automatically selected by the Appion DoGpicker initially |
---|---|
CTF correction | Details: ACE |
Final reconstruction | Algorithm: OTHER / Resolution.type: BY AUTHOR / Resolution: 19.8 Å / Resolution method: FSC 0.5 CUT-OFF / Software - Name: EMAN, SPIDER Details: EMAN interleaved with SPIDER correspondence analysis Number images used: 14097 |
Final two d classification | Number classes: 280 |
-Atomic model buiding 1
Initial model | PDB ID: |
---|---|
Software | Name: Chimera, Yup.scx |
Details | Protocol: rigid body, Yup.scx simulated annealing. A complete ternary complex model was generated using multiple PDB entries, with a homology modelling step for RNAP. The model was regularized with PHENIX and the refined against the EM map with Yup.scx using default parameters. |
Refinement | Space: REAL / Protocol: RIGID BODY FIT / Target criteria: map-derived potential energy |
Output model | PDB-3iyd: |
-Atomic model buiding 2
Initial model | PDB ID: |
---|---|
Software | Name: Chimera, Yup.scx |
Details | Protocol: rigid body fit followed by Yup.scx simulated annealing. A complete ternary complex model was generated using multiple PDB entries, with a homology modelling step for RNAP. The model was regularized with PHENIX and the refined against the EM map with Yup.scx using default parameters. |
Refinement | Space: REAL / Protocol: RIGID BODY FIT / Target criteria: map-derived potential energy |
Output model | PDB-3iyd: |
-Atomic model buiding 3
Initial model | PDB ID: Chain - Chain ID: A |
---|---|
Software | Name: Chimera, Yup.scx |
Details | Protocol: manual fit followed by Yup.scx simulated annealing. A complete ternary complex model was generated using multiple PDB entries, with a homology modelling step for RNAP. The model was regularized with PHENIX and the refined against the EM map with Yup.scx using default parameters. |
Refinement | Space: REAL / Protocol: RIGID BODY FIT / Target criteria: map-derived potential energy |
Output model | PDB-3iyd: |
-Atomic model buiding 4
Initial model | PDB ID: Chain - Chain ID: A |
---|---|
Software | Name: Chimera, Yup.scx |
Details | Protocol: rigid body fit followed by Yup.scx simulated annealing. A complete ternary complex model was generated using multiple PDB entries, with a homology modelling step for RNAP. The model was regularized with PHENIX and the refined against the EM map with Yup.scx using default parameters. |
Refinement | Space: REAL / Protocol: RIGID BODY FIT / Target criteria: map-derived potential energy |
Output model | PDB-3iyd: |
-Atomic model buiding 5
Initial model | PDB ID: |
---|---|
Software | Name: Chimera, Modeller, Yup.scx |
Details | Protocol: rigid body fit followed by Yup.scx simulated annealing. A complete ternary complex model was generated using multiple PDB entries, with a homology modelling step for RNAP. The model was regularized with PHENIX and the refined against the EM map with Yup.scx using default parameters. |
Refinement | Space: REAL / Protocol: RIGID BODY FIT / Target criteria: map-derived potential energy |
Output model | PDB-3iyd: |