3D Electron Microscopy (3D-EM) Data Navigator [English / 日本語]
Top Gallery List Diagram Statistics Viewer Documents
Movie pageYodrodumi (structure viewer)
PDBj>EM Navigator>Detail page - EMDB-5127

Three-dimensional EM structure of an intact activator-dependent transcription initiation complex

by single particle reconstruction, at 19.8 A resolution

Movie

Orientation:

#1: Surface view with section colored by density value, Surface level: 2.8, Image by UCSF CHIMERA

#2: Surface view colored by radius, Surface level: 2.8, Image by UCSF CHIMERA

#3: Surface view with fitted model, atomic models: PDB-3iyd, Surface level: 2.8, Image by UCSF CHIMERA

Entry
Summary
Database / IDEM DATA BANK (EMDB) / 5127
TitleThree-dimensional EM structure of an intact activator-dependent transcription initiation complex
MapE. coli Class I transcription activation complex
SampleE. coli RNA polymerase holoenzyme (sigma70) and E. coli catabolite activator protein (CAP) bound to 98-mer DNA containing the lac promoter and engineered open transcription bubble
Keywordstranscription, initiation, Class I, activator, RNA polymerase, holoenzyme, sigma70, open complex, CAP, CRP, cAMP-dependent, DNA, prokaryotic
AuthorsHudson BP, Quispe J, Lara S, Kim Y, Berman HM, Arnold E, Ebright RH, Lawson CL
DateDeposition: 2009-07-30, Header release: 2009-08-24, Map release: 2009-11-04, Last update: 2012-05-21
EMDB SitesEMDB @PDBe (EU), EMDB @RCSB (USA)
Structure Visualization
MoviesMovie Page

#1: Surface view with section colored by density value, Surface level: 2.8, Image by UCSF CHIMERA

#2: Surface view colored by radius, Surface level: 2.8, Image by UCSF CHIMERA

#3: Surface view with fitted model, atomic models: PDB-3iyd, Surface level: 2.8, Image by UCSF CHIMERA

Supplemental images
Structure viewersYorodumi, Launch PeppeR (About PeppeR), Volume viewer (RCSB, PDBe)
Related Structure Data
Related Entries

PDB-3iyd

CiteFit

Cite: data citing same article

Fit: output model of fitting

Similar-shape strucutres
Search for similar-shape assemblies throgh:
EMDB + EM entries in PDB
all of EMDB & PDB (Omokage search)
Article
Citation - Primary
ArticleProc. Natl. Acad. Sci. U.S.A., Vol. 106, Issue 47, Page 19830-5, Year 2009
TitleThree-dimensional EM structure of an intact activator-dependent transcription initiation complex.
AuthorsBrian P Hudson, Joel Quispe, Samuel Lara-González, Younggyu Kim, Helen M Berman, Eddy Arnold, Richard H Ebright, Catherine L Lawson
Department of Chemistry and Chemical Biology, Rutgers University, 610 Taylor Road, Piscataway, NJ 08854, USA.
KeywordsBase Sequence, Cyclic AMP Receptor Protein (chemistry), DNA, Bacterial (chemistry), DNA-Directed RNA Polymerases (chemistry, 2.7.7.6), Escherichia coli Proteins (chemistry), Macromolecular Substances (chemistry), Models, Molecular, Molecular Sequence Data, Nucleic Acid Conformation, Promoter Regions, Genetic, Protein Structure, Tertiary, Protein Subunits (chemistry), Transcription, Genetic
LinksDOI: 10.1073/pnas.0908782106, PubMed: 19903881, PMC: PMC2775702
Map
Fileemd_5127.map.gz ( map file in CCP4 format, 2001 KB )
Projections & SlicesSize of images:
AxesZ (Sec.)Y (Row.)X (Col.)
80 pix
4.64 A/pix
= 371.2 A
80 pix
4.64 A/pix
= 371.2 A
80 pix
4.64 A/pix
= 371.2 A

Surface

Projections

Slices (1/3)

Slices (1/2)

Slices (2/3)

Images are generated by Spider package.

Density
Contour Level:2.8 (by author), 2.8 (movie #1):
Minimum - Maximum: -3.34078479 - 14.39524174
Average (Standard dev.): 0E-8 (0.90271008)
Data TypeImage stored as Reals
Space Group Number1
Map Geometry
Axis orderXYZ
Dimensions808080
Origin-40-40-40
Limit393939
Spacing808080
Unit CellA= B= C: 371.19998 A
Alpha=beta=gamma: 90 degrees
Pixel SpacingX= Y= Z: 4.64 A
CCP4 map header info
modeImage stored as Reals
A/pix X/Y/Z4.644.644.64
M x/y/z808080
origin x/y/z0.0000.0000.000
length x/y/z371.200371.200371.200
alpha/beta/gamma90.00090.00090.000
start NX/NY/NZ-34-26-72
NX/NY/NZ6953145
MAP C/R/S123
start NC/NR/NS-40-40-40
NC/NR/NS808080
start NC,NX/NR,NY/NS,NZ
NC,NX/NR,NY/NS,NZ
D min/max/mean-3.34114.395-0.000
Annotation DetailsE. coli Class I transcription activation complex
Supplement
Images
Images
Sample
NameE. coli RNA polymerase holoenzyme (sigma70) and E. coli catabolite activator protein (CAP) bound to 98-mer DNA containing the lac promoter and engineered open transcription bubble
Number of Components3
Oligomeric StateOne molecule of RNAP (containing six subunits) and one CAP homodimer bound to a DNA duplex)
Theoretical Mass0.57MDa
DetailsComplex formation was verified by gel shift
Component #1: protein - CAP
Scientific nameCatabolite Activator Protein
Common NameCAP
Theoretical Mass0.05 MDa
Oligomeric Detailshomodimer
Number of Copies1
Scientific Name of SpeciesEscherichia coli

NCBI taxonomy562
StrainK12
Recombinant expressionYes
Engineered SourceNCBI taxonomy: 469008
Expression system: Escherichia coli BL21(DE3)
Vector: pET21(a)
LinksGene Ontology: GO:0006355, Inter Pro: IPR:001808
Component #2: nucleic-acid - lac(ICAP)UP-UV5-bubble
Scientific namelac(ICAP)UP-UV5-bubble
Theoretical Mass0.06 MDa
Experimental Mass0.06 MDa
DetailsAn engineered 98mer duplex based on positions -78 to 20 of the Class I CAP-dependent promoter lac but containing consensus -10 sequence and consensus binding sites for CAP and RNAP alpha-CTD. Positions -11 to 2 are non-complementary to create an artificial transcription bubble. Top strand 5'-CGCAATAAATGTGATCTAGATCACATTTTAGGCAAAAAAGGCTTTACACT TTATGCTTCCGGCTCGTATAATCGCACCTTATGTGAGCGGATAACAAG-3' Bottom strand 5'-CTTGTTATCCGCTCACAATTCCACACTAATAACGAGCCGGAAGCATAAAG TGTAAAGCCTTTTTTGCCTAAAATGTGATCTAGATCACATTTATTGCG-3'
Scientific Name of Speciesunidentified
NCBI taxonomy32644
ClassDNA
StructureOTHER
SyntheticYes
Component #3: protein - RNAP
Scientific nameRNA polymerase holoenzyme (sigma70)
Common NameRNAP
Theoretical Mass0.46 MDa
DetailsSix subunits include alphaI (RpoA), alphaII (RpoA), beta (RpoB), beta prime (RpoC) with C-terminal 6His-tag, omega (RpoZ), and sigma70.
Oligomeric Detailsheterohexamer
Number of Copies1
Scientific Name of SpeciesEscherichia coli
Common Name of SpeciesEscherichia coli
NCBI taxonomy562
StrainK12
Recombinant expressionYes
Engineered SourceVector: pEcABC-H6, pRSFduet-sigma, pCDF-omega
NCBI taxonomy: 469008
Expression system: Escherichia coli BL21(DE3)
LinksGene Ontology: GO:0006351
Experiment
Sample Preparation
StainingSample and 2% uranyl formate stain were applied to the grid in rapid succession, with the last drop of stain remaining on the sample for 1 minute. The grid was then submerged in stain and brought up under thin carbon to form an upper sandwich layer. The grid was then blotted and dried for 10 minutes.
Specimen Conc6.18 mg/ml
Specimen Support Details400-mesh copper 2.0x0.5 hole pattern C-flat grid covered with thin layer of continuous carbon
Specimen Stateparticle
BufferDetails: 25mM HEPES, 100mM KCl, 10mM MgCl2, 1mM DTT, 0.2mM cAMP
pH: 8
Vitrification
Cryogen NameNONE
InstrumentNONE
Imaging
MicroscopeFEI TECNAI F20
Date04-NOV-2008
Details15 um pixel size on detector
Electron Gun
Electron SourceFIELD EMISSION GUN
Accelerating Voltage120 kV
Electron Dose16 e/A**2
Illumination ModeFLOOD BEAM
Lens
MagnificationNominal: 50000
Nominal Cs2 mm
Imaging ModeBRIGHT FIELD
Defocus500 nm - 1500 nm
Specimen Holder
Holderstandard side-entry room-temperature stage
ModelSIDE ENTRY, EUCENTRIC
Temperature293 K
Camera
DetectorTVIPS TEMCAM-F415 (4k x 4k)
Image Acquisition
#1
Number of Digital Images349
Processing
Methodsingle particle reconstruction
3D reconstruction
Algorithmprojection matching
SoftwareEMAN, SPIDER
CTF CorrectionACE
DetailsEMAN interleaved with SPIDER correspondence analysis
Resolution By Author19.8 A
Resolution MethodFSC 0.5
Single Particle
Number of Class Averages280
Number of Projections14097
Details32816 particles were automatically selected by the Appion DoGpicker initially
Applied SymmetryC1 (asymmetric)
Atomic Model Fitting
Model #0
Refinement SpaceREAL
SoftwareChimera, Yup.scx
Target Criteriamap-derived potential energy
DetailsProtocol: rigid body, Yup.scx simulated annealing. A complete ternary complex model was generated using multiple PDB entries, with a homology modelling step for RNAP. The model was regularized with PHENIX and the refined against the EM map with Yup.scx using default parameters.
Refinement Protocolrigid body
PDB Entry ID1LB2
Model #1
Refinement SpaceREAL
DetailsProtocol: rigid body fit followed by Yup.scx simulated annealing. A complete ternary complex model was generated using multiple PDB entries, with a homology modelling step for RNAP. The model was regularized with PHENIX and the refined against the EM map with Yup.scx using default parameters.
SoftwareChimera, Yup.scx
Refinement Protocolrigid body
Target Criteriamap-derived potential energy
PDB Entry ID1BDF
Model #2
Refinement Protocolrigid body
Target Criteriamap-derived potential energy
DetailsProtocol: manual fit followed by Yup.scx simulated annealing. A complete ternary complex model was generated using multiple PDB entries, with a homology modelling step for RNAP. The model was regularized with PHENIX and the refined against the EM map with Yup.scx using default parameters.
Refinement SpaceREAL
SoftwareChimera, Yup.scx
PDB Entry ID2AUK
PDB Chain IDA
Model #3
Refinement Protocolrigid body
Target Criteriamap-derived potential energy
DetailsProtocol: rigid body fit followed by Yup.scx simulated annealing. A complete ternary complex model was generated using multiple PDB entries, with a homology modelling step for RNAP. The model was regularized with PHENIX and the refined against the EM map with Yup.scx using default parameters.
Refinement SpaceREAL
SoftwareChimera, Yup.scx
PDB Entry ID1SIG
PDB Chain IDA
Model #4
DetailsProtocol: rigid body fit followed by Yup.scx simulated annealing. A complete ternary complex model was generated using multiple PDB entries, with a homology modelling step for RNAP. The model was regularized with PHENIX and the refined against the EM map with Yup.scx using default parameters.
Refinement Protocolrigid body
Refinement SpaceREAL
SoftwareChimera, Modeller, Yup.scx
Target Criteriamap-derived potential energy
PDB Entry ID3DXJ
Fitted Coordinate
PDB entry ID
Download
Data from EMDB
Header (meta data in XML format)emd-5127.xml (14 KB)
Map dataemd_5127.map.gz (1.3 MB)
Imagesemd_5127_1.tif (764.8 KB)
FTP directoryftp://ftp.pdbj.org/pub/emdb/structures/EMD-5127
Movie files
movie #1
.mp4 (H.264/MPEG-4 AVC format), 3.5 MB
.webm (WebM/VP8 format), 5.4 MB
Session file for UCSF-Chimera, 26.4 KB
movie #2
.mp4 (H.264/MPEG-4 AVC format), 3.2 MB
.webm (WebM/VP8 format), 4.7 MB
Session file for UCSF-Chimera, 26.4 KB
movie #3
.mp4 (H.264/MPEG-4 AVC format), 3.5 MB
.webm (WebM/VP8 format), 4.5 MB
Session file for UCSF-Chimera, 3.8 MB